Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YIL102C
Systematic Name YIL102C
Strain S288c
Description Putative protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YIL102C YIL102C
CGCAGAAACTTGTTATTGAGGACGCCTTGCCCTCATTCGACTCATTTGTAGAAAACTTGG
GCCTTTCCTCAAATGACAAGAACTTCATTAAAAAAAACAGCAAAAGGCAAAAGTCGTCCA
CATACACCTCTCAAACTTCTTCTCCAATAGGGCCAAGAGATCCAACGGTGCAAATTTTGT
CAAACCTAGCATCCTTCTACAACACCCACGGTCACCGGTATTCATATCCGGGAAATATCT
ATATACCACAGCAAAGATACTCTTTACCCCCACCAAACCAGCTCTCGTCGCCACAGCGGC
AGCTAAACTATACTTACGACCACATTCACCCAGTTCCTTCTCAGTACCAGTCTCCAAGAC
ACTACAACGTCCCCTCTTCACCAATCGCGCCTGCTCCTCCCACTTTCCCTCAACCTTATG
GTGATGATCACTATCATTTTTTGAAATATGCTAGCGAAGTTTATAAGCAACAAAACCAAC
GACCAGCTCATAATACAAATACCAATATGGACACCTCTTTTTCGCCAAGGGCGAACAATT
CACTGAACAATTTCAAATTTAAAACAAACTCAAAACAATAAAAATGTCATCTGTTACATT
TTTGGTAATATTCTTTTATAATGGTTCTTTAATTTTTTTACATAATTTACATATTATTTC
AAAGTTTTTCAAAAATATCCGTACTATATGTTTTTCCAGACAAAACATAAAACATACAAT
GATCTTTTTGAAGAGAGAATTAGTACACTCATTACAAGGTGTATGACGTGCCGAAGAAAA
AAATTGCTTCCAATCGGATTTGAACCGATGATCTCCACATTACTAGTGTGGCGCCTTACC
AACTTGGCCATAGAAGCTCGTACTTGTTGGTTCAGTACTCTTCATCAAGCTATACTATTT
ATCTAGGATGACGGTCACAGTGATTCGTACTCGACTGCTTCTATAATCTGTAGGTGGCTT
GCGCATATCCTGAATTATCGTAATTAAAGAACCAAGTTAG
Chr coordinates Chr IX from 174887-174582
w3c xhtml validator w3c css validator