Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HOS4
Systematic Name YIL112W
Strain S288c
Description Subunit of the Set3 complex, which is a meiotic-specific repressor of sporulation specific genes that contains deacetylase activity; potential Cdc28p substrate
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HOS4 YIL112W
ATCGCACCAAAGAGTGGCCAAAGACCATCTCTTCCTATGCTGGCCACAGATGAGAGGTCT
ACGGACAAAGAAAGCCCGAATGAAGACCGTGAATTCGTGCCTTGTTCGAGTTTGGACGTG
CGCAGAATCTACCCAAAAGGCCCATTACTTGTTCTCCCGGAAAAGATCTACCTTTATTCA
GAGCCCACGGTAAAAGAGCTTTTACCCTTTGATGTGGTCATCAACGTTGCTGAAGAGGCA
AACGATTTACGAATGCAGGTTCCTGCTGTCGAGTACCATCACTACCGATGGGAACATGAT
TCGCAGATTGCGTTGGACTTGCCATCATTGACTAGCATCATACACGCAGCTACGACTAAG
CGAGAGAAGATACTGATACATTGCCAATGTGGGCTGTCGAGATCCGCAACGCTGATTATT
GCATATATAATGAAATATCATAACTTGAGTCTGAGGCACTCATATGATCTGTTGAAATCA
AGGGCAGACAAGATAAACCCTTCCATAGGGCTTATTTTCCAGTTGATGGAATGGGAGGTT
GCTCTTAACGCGAAGACTAACGTGCAAGCCAACAGTTATAGAAAAGTACCGTGAGAGAGA
AAAAAAAAAAAGATATAGCATTCAATGAGGCTTTATTGAGGGGCACGATGCTCTTTTTTT
CTTCTGTACTTTATAAATAATTCCGTATTTCTTCGCTTTGTTTCATGCTCTGTTCTGAGC
TTTTAGTTTCTCTTATTGAGAGCCTTTTCCAAATCAAGGCTCAGGAAGTGACTCGTCCTT
AGAAGAACAAGGTTTGGATTTGGTAGGGTTCTTGTACGAAGTTCTCAATATAATTTGCGC
ATTTACTGTACGGTTCATACTAGTTTATTCCGGGTAACAAGTTTTCTTGTGATGCTAAAT
CAATGTGTATATTGAGAAAACTATGTAGTAAGTTACACAAAGCAACAAAGGATATTATTA
TATGTGACAGAGAAGAATTGCTGTAGAGATTCATGACAAT
Chr coordinates Chr IX from 151595-154846
w3c xhtml validator w3c css validator