Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HIS5
Systematic Name YIL116W
Strain S288c
Description Histidinol-phosphate aminotransferase, catalyzes the seventh step in histidine biosynthesis; responsive to general control of amino acid biosynthesis; mutations cause histidine auxotrophy and sensitivity to Cu, Co, and Ni salts
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HIS5 YIL116W
CTTTGCGCCTTTTGCTCCGCCGCTCTTTCGTCGGCGTTCTTTGCTTCCCTGGGCGCTGTC
GCATTAAGAATATCATGTATATTCAGGAACAAAGGTAAATCACCTATAGACGTGCGCCGC
AATAACCCTGCTAAGAAAATTCATTTAAAAAACTTACCTGCCAGTCTTGTTGTTTACTCA
AACCACATACTATGATTATACTTTTGTCAGAGTTATGCGATGCCGCTTAAGCTTTGATTA
AGAATTTTTTTCTCTTCTTTAAGTATGCCGTGCACTTTTCGCTTCTCCAAAATATGACCC
AATACTCATTTGGTTATTTTTACCAAGTAATCGATCAGATAGCATTAATAGCGTGAATAT
TTGATGGAATAACATATTAGAAAAGCTTTAGCTGGCAATTCTTGTACTGTCTTTCGCCGA
AACCTGTTTGATGACTACTTCATCAATTTTTTTTTTTTCTGCCGCATTCCAAAGGTCATA
ACTTTGCAAAAATAAAGGGTAAATGGTTAAAAATTGTTATCATAAATAAGGTGACCGGTT
ATATTGAGACCTTTCCTGGACAGTAACTAATACAGAAGCCATTGGTAATGCAATAATTTA
TTTGATCATGTGACTACGATCCGGGTGAGACTATTCAAAAAAGGAGTCAAGCATTGAAAT
AATTAATGACTAATCCGAAGTTAATTGTTAGGAGTCAATTGTTTTTTCCAATGAATGGAA
TCTGAGATGACTAAACTACCAATTTTCAATAGTTCATGGTATAGTGACGTAGTTAGTGCT
TTTTTTTCTTGGATCTGTTGACTCACTTCAATTGATGTTTCTTACCCTGACATGACATAC
TTGATATTTTATCTCTCACGTTATATAACTTGAAAAGGATGCACACAGTTCTGTTCAATA
TACCCTCCAATATGTAAAAACAGTTTTTCCATTGATTACTCTTAATTTGTTTCCTGCTAA
ACCAGCAGTACGTGTGTGCCGTATATATTAAAATTACACT
Chr coordinates Chr IX from 142928-144085
w3c xhtml validator w3c css validator