Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HIS5
Systematic Name YIL116W
Strain S288c
Description Histidinol-phosphate aminotransferase, catalyzes the seventh step in histidine biosynthesis; responsive to general control of amino acid biosynthesis; mutations cause histidine auxotrophy and sensitivity to Cu, Co, and Ni salts
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>HIS5 YIL116W
ATGGTTTTTGATTTGAAAAGAATTGTTAGACCAAAAATTTATAACTTGGAACCTTATCGC
TGTGCAAGAGATGATTTCACCGAGGGTATATTGCTAGACGCCAATGAAAATGCCCATGGA
CCTACTCCAGTTGAATTGAGCAAGACCAATTTACATCGTTACCCGGATCCTCACCAATTG
GAATTCAAGACCGCAATGACGAAATACAGGAACAAAACAAGCAGTTATGCCAATGACCCA
GAGGTAAAACCTTTAACTGCTGACAATCTGTGCCTAGGTGTGGGATCTGATGAGAGTATT
GATGCTATTATTAGAGCATGCTGTGTTCCCGGGAAAGAAAAGATTCTGGTTCTTCCACCA
ACATATTCTATGTACTCTGTTTGTGCAAACATTAATGATATAGAAGTCGTCCAATGTCCT
TTAACTGTTTCCGACGGTTCTTTTCAAATGGATACCGAAGCTGTATTAACCATTTTGAAA
AACGACTCGCTAATTAAGTTGATGTTCGTTACTTCACCAGGTAATCCAACCGGAGCCAAA
ATTAAGACCAGTTTAATCGAAAAGGTCTTACAGAATTGGGACAATGGGTTAGTCGTTGTT
GATGAAGCTTACGTAGATTTTTGTGGTGGCTCTACAGCTCCACTAGTCACCAAGTATCCT
AACTTGGTTACTTTGCAAACTCTATCCAAGTCATTCGGTTTAGCCGGGATTAGGTTGGGT
ATGACATATGCAACAGCAGAGTTGGCCAGAATTTTAAATGCAATGAAGGCGCCTTATAAT
ATTTCCTCCCTAGCCTCTGAATATGCACTAAAAGCTGTTCAAGACAGTAATCTAAAGAAG
ATGGAAGCCACTTCGAAAATAATCAATGAAGAGAAAATGCGCCTCTTAAAGGAATTAACT
GCTTTGGATTACGTTGATGACCAATATGTTGGTGGATTAGATGCTAATTTTCTTTTAATA
CGGATCAACGGGGGTGACAATGTCTTGGCAAAGAAGTTATATTACCAATTGGCTACTCAA
TCTGGGGTTGTCGTCAGATTTAGAGGTAACGAATTAGGCTGTTCCGGATGTTTGAGAATT
ACCGTTGGAACCCATGAGGAGAACACACATTTGATAAAGTACTTCAAGGAGACGTTATAT
AAGCTGGCCAATGAATAA
Promoter Sequence
Download FASTA
>HIS5 YIL116W
CTTTGCGCCTTTTGCTCCGCCGCTCTTTCGTCGGCGTTCTTTGCTTCCCTGGGCGCTGTC
GCATTAAGAATATCATGTATATTCAGGAACAAAGGTAAATCACCTATAGACGTGCGCCGC
AATAACCCTGCTAAGAAAATTCATTTAAAAAACTTACCTGCCAGTCTTGTTGTTTACTCA
AACCACATACTATGATTATACTTTTGTCAGAGTTATGCGATGCCGCTTAAGCTTTGATTA
AGAATTTTTTTCTCTTCTTTAAGTATGCCGTGCACTTTTCGCTTCTCCAAAATATGACCC
AATACTCATTTGGTTATTTTTACCAAGTAATCGATCAGATAGCATTAATAGCGTGAATAT
TTGATGGAATAACATATTAGAAAAGCTTTAGCTGGCAATTCTTGTACTGTCTTTCGCCGA
AACCTGTTTGATGACTACTTCATCAATTTTTTTTTTTTCTGCCGCATTCCAAAGGTCATA
ACTTTGCAAAAATAAAGGGTAAATGGTTAAAAATTGTTATCATAAATAAGGTGACCGGTT
ATATTGAGACCTTTCCTGGACAGTAACTAATACAGAAGCCATTGGTAATGCAATAATTTA
TTTGATCATGTGACTACGATCCGGGTGAGACTATTCAAAAAAGGAGTCAAGCATTGAAAT
AATTAATGACTAATCCGAAGTTAATTGTTAGGAGTCAATTGTTTTTTCCAATGAATGGAA
TCTGAGATGACTAAACTACCAATTTTCAATAGTTCATGGTATAGTGACGTAGTTAGTGCT
TTTTTTTCTTGGATCTGTTGACTCACTTCAATTGATGTTTCTTACCCTGACATGACATAC
TTGATATTTTATCTCTCACGTTATATAACTTGAAAAGGATGCACACAGTTCTGTTCAATA
TACCCTCCAATATGTAAAAACAGTTTTTCCATTGATTACTCTTAATTTGTTTCCTGCTAA
ACCAGCAGTACGTGTGTGCCGTATATATTAAAATTACACT
Chr coordinates Chr IX from 142928-144085
w3c xhtml validator w3c css validator