Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PRM5
Systematic Name YIL117C
Strain S288c
Description Pheromone-regulated protein, predicted to have 1 transmembrane segment; induced during cell integrity signaling
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PRM5 YIL117C
TTTTTTGAATAGTCTCACCCGGATCGTAGTCACATGATCAAATAAATTATTGCATTACCA
ATGGCTTCTGTATTAGTTACTGTCCAGGAAAGGTCTCAATATAACCGGTCACCTTATTTA
TGATAACAATTTTTAACCATTTACCCTTTATTTTTGCAAAGTTATGACCTTTGGAATGCG
GCAGAAAAAAAAAAAATTGATGAAGTAGTCATCAAACAGGTTTCGGCGAAAGACAGTACA
AGAATTGCCAGCTAAAGCTTTTCTAATATGTTATTCCATCAAATATTCACGCTATTAATG
CTATCTGATCGATTACTTGGTAAAAATAACCAAATGAGTATTGGGTCATATTTTGGAGAA
GCGAAAAGTGCACGGCATACTTAAAGAAGAGAAAAAAATTCTTAATCAAAGCTTAAGCGG
CATCGCATAACTCTGACAAAAGTATAATCATAGTATGTGGTTTGAGTAAACAACAAGACT
GGCAGGTAAGTTTTTTAAATGAATTTTCTTAGCAGGGTTATTGCGGCGCACGTCTATAGG
TGATTTACCTTTGTTCCTGAATATACATGATATTCTTAATGCGACAGCGCCCAGGGAAGC
AAAGAACGCCGACGAAAGAGCGGCGGAGCAAAAGGCGCAAAGTGACACCTTCCGATCCTG
GGAAGTGATCGGTTTCGCTGTTCGGGCTTTTCTTAGACAAATAAAGTTTAATTTTCTTGC
TTTCTCTTTTTGGCTAAGAATTCTATATTGTTCTTGAAACAACTTTGTCACACGTTCTAA
AAATAAAATGGAAAATGGAAAATGAAAAATTAGAGAGAAAATGTATTACTGAAGAATGTG
GTAAAGACATTTGAAAAATATTTAATATATTACCTGAGATCATTCAAAGGAACGCATCGG
TGCAAAGAAACAGTTATAGCATTAGAGTTAAGTCAAGAGCACTCATTATTACTTTAAAAG
GTCGTTGAAAATAGAATAAATTGACACTCAAAACGCAAGA
Chr coordinates Chr IX from 141569-140613
w3c xhtml validator w3c css validator