Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name QDR2
Systematic Name YIL121W
Strain S288c
Description Multidrug transporter of the major facilitator superfamily, required for resistance to quinidine, barban, cisplatin, and bleomycin; may have a role in potassium uptake
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>QDR2 YIL121W
GCAACCCGTATATGCAACCTCCGCAACCACAAGTGCAACAGATAATGCCGCAGTATTTAT
ATCCACCAGGGATGGGACCACAAGCTCAGCTTCCTACAATGAGCTCAAACTCGGAGTCCC
AGACACCAGTGATGAGCTCACAGTTTCTTTCCTTGAACCAGCATGGCCTTTACCAACAAA
ATATAGGTGCTCATCCGGTAATGAGTATGGGCCCACAGGCAAATATATACGGGCAGCAGC
ACCAGCTGCAACCTGGTCAGGAACGAGACCAGTCAAGAAAAAGTTTTAGTCATAGAAGGT
CACAAAGTGCCAATATTTCCATGGCAAATTTTAGGTCGCCCATGCGAAATCCCCAGCCGG
CTTCGTCCCAAAGGCCCGTCAATTTTCTCATTCATACACCAAAACATCCTCCTCCCACAT
GACGTGCAGTAATTTTCATTTTTATCACCTAATTTCTAAAACTATATCCCTTCCTAACCT
TCATTCGATGCATCCGTCCACCTTACTTCAGTTCAAAAAAAAATATATATCCATATATAT
GCTACAGTGTTATTATTACGATTTCTTTGCCTTTACTCCTTATCTCATTTCAATCATGAA
TAAACAGGATATTGATAATATATGCTGTCATTTTGGATTCAGTCTGCTTAACTGTCTTGT
CCACCCCCGGTGTTCTTACCCGTCTGAGCGGTCGTAAGACGGAGGTAATAATTTTTCAGC
ATCCTGACCTCCCCCCCAAATCTGTGCCTTTCACCACATTTTTCTCGAGAAAATGTGTCT
TGGCTCAGATGATGTCGTATGAGCTACTGGACTTTTTTTTGTTGGCCCTGATGAAAATAG
TAATGGCGGTTACAGAACAGATAAACGGCGTCACCATCTTTTCCTAGATAAAGAAGCAAT
CTCTAGATAATGGGGTATATAAATATACATTGTAAAAACGGCAAGTCAGTTGCTGGTCAT
TTTAGTAGAAACTCTGCTCTCAAACTTGAGTACTGCAACG
Chr coordinates Chr IX from 132244-133872
w3c xhtml validator w3c css validator