Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name POG1
Systematic Name YIL122W
Strain S288c
Description Nuclear chromatin-associated protein of unknown function; overexpression promotes recovery from pheromone induced arrest and suppresses the stress sensitivity caused by a mutation in the E3 ubiquitin ligase Rsp5p; binds upstream of BAR1 and cell cycle-related genes; potential Cdc28p substrate; SBF regulated
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>POG1 YIL122W
TTTTCTTTTTTCGAACACATCTCACCCCCTATACCTCACACAATCACTATGGTCCCCTTT
TCTTTTTACCGATATTTATACTGTCCACCTTTTTCTTTTCGTTAATGGCCTCAATGTTTC
TGTACCATTATCCAAGTGAACTTGTTAGACGACCAAATATAGCCAAGATTCATTACGATT
ATCTTTAACTAGCAAGTAGTATTCTTGGATAGAGAGATTTTCAAAGACGGAACAATTTTA
AATAGATTTACATAAGAAAACACATACTGTCCGATACCCATAAGAAATTTAAGAACTCTT
TTCATCTTCAGCTTTCCGGCCTCCTTTTACTGTAGCCTGTTCCTAGACAGCTAAAAATAG
TACATATGCAGCTCTGCAATAGTCTCAAAGGGGATATTGTGTAGGTTTACGAAATCATCA
CATTTCCGAATCAGGACATGAAGGCACAACTTTCCGCACGTAGTGTTTTCAGCCCCCAGC
GCCTGTCGGCGCGAAGAGGATCTGCGGAGATGAGCTTTGCCCCGCCATTACCCGTAAAAT
ATTACTGTTTTGGGCAATTGTGGATCAAAAAGGGAAAATGCGGATGGTGAAAAAAATTTT
TGGAAATTTACTGCTTCAGATGGGGGAACTTTGTAAGTTCTTCCTTTTTTTTCGTAGAGG
TTGGAAAATTCAGAGTGCTAAGAAATTAAAAGGTATGCACTGCCTATTCTCATAAAAGCA
AAAGTGCACAAAAATAATAAGGTGTGAAGCAATAGTAGAAAAGACACTGGGAACCCAAGG
TATCTTATTTTAACAGATAAGTAAAACTAAGATCAAATCGCGTACTGATATCACTTAAGG
TTCGCGTATTTTAAAGGCTACGCAGAAGAGGAAATAAATTGCGTGCAATCCCTGCGCTTA
ACTCATACAAAAAGGCGCAAAACATTTCAAGAGTCCCACGATTAATTGCAGAAATTGAAA
AAAAATAAGTAAAGACGAAAATCAAAGTGGATGCCATATT
Chr coordinates Chr IX from 130610-131665
w3c xhtml validator w3c css validator