Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name AYR1
Systematic Name YIL124W
Alias GBG1
Strain S288c
Description Bifunctional triacylglycerol lipase and 1-acyl DHAP reductase; NADPH-dependent 1-acyl dihydroxyacetone phosphate reductase involved in phosphatidic acid biosynthesis; lipid droplet triacylglycerol lipase involved in mobilization of non-polar lipids; found in lipid particles, endoplasmic reticulum and mitochondrial outer membrane; forms NADPH-regulated channel in mitochondrial outer membrane; required for spore germination; role in cell wall biosynthesis; capable of metabolizing steroid hormones
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>AYR1 YIL124W
GTCAATTCCGTAAACCATTGGCGTTATTCTTTTCTAAACAGCTGCTGCGTCACCCATTGG
CCAGATCATCTCTTTCCGAATTCACTGAAGGCGGATTCCAATGGATTATCGAAGATATTG
AACATGGAAAAAGTATTGGTACGAAAGAGGAAACCAAGAGATTAGTTTTGCTGAGTGGCC
AAGTGTACACTGCCCTACATAAAAGACGTGAAAGTTTGGGTGATAAGACCACTGCTTTCT
TAAAGATTGAACAGCTGCACCCATTCCCATTTGCTCAGCTACGTGATTCATTAAATTCTT
ATCCAAACTTGGAAGAAATTGTTTGGTGCCAGGAAGAGCCATTGAACATGGGTTCGTGGG
CATACACAGAACCACGCTTACACACAACATTAAAAGAAACGGATAAATATAAGGATTTCA
AGGTCAGATACTGTGGTAGAAACCCAAGTGGTGCTGTTGCTGCCGGTAGCAAATCACTAC
ATTTGGCCGAAGAAGATGCCTTTTTGAAAGATGTTTTCCAACAATCCTAAAGATGAATTC
AAATATGAAAAACATGAAAATACAGCCATATAAACACGTAATATTTTTACCTTAATGTTT
ATGGACAGCCTTTTTACTTGAAGAATGATCTAACAAATATTTTTTTTGATACATTCACAT
TTTTTTTTTGTTCATGATGTTAGCATCTGCTTAGTCTTTTTAAAATTATTTAATTTAACG
TTTTATTTATGTGAACCTTTTTTTATTAGTTGTATTTACTATTTATTCAAGAATCATTCT
TTACTTTATATTGATATCGTTTTTTTCCCCCTACTTCCTCCTCTGGTGTATTCACAGCTA
GGTGCTTCTCTTGTCCTCATCCGGTGGAGAAAAAAAGTGAAAAATAAGTCAATGGAAAGG
GGGAAGGGGGTAGGTAAATAGAGTGAATAAGTTTTATTCATCATGCCCAACTTCTATTAA
TATATACTCAATTCAAATATTGATCAGGATTTCAAAGAGT
Chr coordinates Chr IX from 126204-127097
w3c xhtml validator w3c css validator