Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TAO3
Systematic Name YIL129C
Alias PAG1
Strain S288c
Description Component of the RAM signaling network that is involved in regulation of Ace2p activity and cellular morphogenesis, interacts with protein kinase Cbk1p and also with Kic1p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TAO3 YIL129C
TCTAGTTGATGCCAAATGCTGGCCTTGTTGATAGTTGTCCAATAATAATCTCAAAAGTTG
GGCTATCTCGTTAATGGAGACATATTTCATTGGAGCTAATGCGGCGAAGCCCTCCAAGAC
TTCTTTTGCAAGCGCTTGATCATCAAGCTTAGACTGGTAAAACTGAAATATTACTGAGCA
TTCGTTTTTGGAGAGGTGGTCCTTGGGAGTTTTTGCTAAGATAGTGGTTAAACATGTCAA
CGCTTTCTTCCTTTCTACCTCATTTTCTGAAAGAAAATAATCTTTCAACGCAACGACAAC
TTCCAGCAATTTTATTGATCGGTGTACAATAGAATCCGTTACTGTGGAAGCGGTTTCGTT
GGCCTTCGAATCATCAATATTCAGATTGGCCATAAAGGTGACGACTGCTGAATTTAGTTC
GTCTGGTGTCATTGTAAGGCCCAATTGTTCCGCTTTTTCCCAGTTAAAACAAGTTCAATG
AAAACTAACAGCTAATAACTAGATGATCATAGAGGTGACTCCTTCATTGCACGTAAAATG
TACATAATCTACAATTCACTTAAATAACTAAACCAAATTTCAGTATTTGAAAAATTCATA
CCTATTACCCGCTTTTAACTTTTTCTTGGCTACTCACTCATGAAGGCCTAAAAAGAAGCT
GCAAAGTGGTATTACCTATCTCGAAGTATGTCCTAGCTCTCTTTGACTCATTGAGGTCAC
CTAGAGTATACCATCCCTTCCAAATTAGCGGTATCAACATCACATACATTGGGAGTTGGT
TGAATCGTTATGGTTGTATCACTAACCACGAAACGACAGCCACACAGGAAAATACATATA
GAACTGTAGAAATTGGGATAAAGGATTAGGCAAATGAAGAGAGAAAGCAAATGTGGATTT
AGGTCTTCATAATAGGACGTGACTGGTTAAAGTGTGAAAATTCTGGTTGTTTGTTGTGTT
CCCATTTTAATAACCCTTTTTAGTTTTGTTATACATCAAA
Chr coordinates Chr IX from 113237-106107
w3c xhtml validator w3c css validator