Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ASG1
Systematic Name YIL130W
Strain S288c
Description Zinc cluster protein proposed to function as a transcriptional regulator involved in the stress response; null mutants have a respiratory deficiency, calcofluor white sensitivity and slightly increased cycloheximide resistance
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ASG1 YIL130W
CCGTAGGAGGAGAGTCTGGACCTGTGGGAATCCTTCTAAAATTGACCTTAGCACCATTTC
TACCGAATATCTGTAATTCCCATGATCCGCTCTCCAGGTTGAATCTGATTGCAGCATGCT
TCCTAGACACAATTTTGGCAGGACCAAGATCAATGTCTATATTCTTCTTCACGACTGTAC
CGGGCACAGCATTCAAGTTCAAGCTGTCTGTGTTCCTACCAATGGTAACTTCTAATTTTT
GTACATAATACGTCCAATCACATCCGGCAATTTTAGCATAAGCGTTGACCTCTCTGGCAA
TACTCAAGCTATTGGAATAGTCACTTGACACAGCCACAGGATCGCTTGACGAGCTAAGAA
CACATGTCACCGCATTAACAAGCCCTTGGCGATCCTGGGCTGTATACGAACTATACTTAC
CACTAAATTTTTGTTCCCTACTGGTAACAGACATTTATTATTACTGTGTCTCTCCAAGCC
TTTCTTTGCTAATTGAACGCACAATTTACACACTATTATTTAAACCTTCAATCTTCTATA
GAGCCGGTATTCATCTAAACCTCTTACCATCCTGTTCTCTCTATACCGTTTCTGATTTGT
TTATGTTTTTCCATTTTTTTGTTTACCTCATCCATGGATCATAACCTATTTCGTAACTTT
TTTAGACCTATCATATATGCTATATTTCCGTTCAAGCCCTTAAAAAACATTTTATAAGAC
CTACGCTCTTCAAGCCCTAGTGATTTCTTTTTTTCTTTTTTTTTTTTTTGGTAATTTTTT
TTTCAAAAGTGACTACAGTAATGAGGTTTGTCTACCTGGACATGACCTTCTATTGTTGAG
TAGTTCCTTGCATTGAAGACAACCAGTAATCGAATTTTTTATAAAGCGGTTAGAAAATCT
CGAAGAGGTTAACATATAGAAAAAAAGCCTCTTTTTATTTGAGTTCCATAAGGTAAGAGA
CAAAGAAAAAGGAGCGCATATTATAATTGATAAGGGCGTT
Chr coordinates Chr IX from 102782-105676
w3c xhtml validator w3c css validator