Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name OM45
Systematic Name YIL136W
Strain S288c
Description Protein of unknown function, major constituent of the mitochondrial outer membrane; located on the outer (cytosolic) face of the outer membrane
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>OM45 YIL136W
GTAAAACTGTCTTCGATAGAAGCTAAGGTGGTGGAGTTCGGATTGAATTTCAAATGGATT
ATGGCGGATCCTTTGAAATTGGGCGACGACTGCTTAGGGTCAATTTCTAGACGCAACTCA
TAGTGACTAGGCACCACCGGATTCTCTAAAGATAACAAATTATCAGACATGATGGTTAGT
GATGATCAACCTGGCGTTATATATCCTTTACACGTCTTCGGACCTTTTTTTTGTATAGCA
CATCCAGGAATGGTTTGACTGCAAAACTCGTTTTTCACTGAAAAATTACCGGCGAATTGT
ATAATAGAAAGGATCGATTTATACTAAAGAAAAGAAGGATTAATATACAAGACTACAACC
AAGGGTGGTACCTCACTTGAAGGGGGTTCTCAAAGTACTCGAGAATTTTGATATTCTGTC
CTGTGTGTGCTGAGCCGTTCCAGCCAGTCTTGTTCCAGAAATATGTTGACAAAATTGAAG
TTCGTAAATATATATACATTTCATATAATAATTGACAAGCTGATACATACGGTGTGCGGA
CGGTTACATTAATGCAGGAATCTATAAATGCTATGGCCAGCTGGCGTCCTTCTGTTATGC
AGATTTCTTAAAATAATTGGCATATTGGTGGTAAACATGAAATGTGAAGACGTTGCCCCT
CGTCATAGGTAAGCGGTGGTCATCACAACCATCAGCGGTGACAATAACACAGCAAACAGT
CTTGTTTGACTCTCCTGCCTGCATGGTGTTTGAAAGTGAATCGTCAGGATTTGCAACAAC
CAATAGTGTACTGCTATTCGCAGGAGCACAAGCTCGCCGGTGGCCCGTGTGGGTTAAGGG
AGGAGTTTGTTGACCCTTATTTTGTCGAGTTCCTTGAAGAGGAGTATATATAAGGGGAAA
CGGTTCTTGCTAAAGTCCTGCTTCTTTGCCCTTTCTTGAAATAAAGGGTATTTTTGATTG
GCCAGTAACGTTAATCATTTAATAAAACAAGCAGATAAGG
Chr coordinates Chr IX from 93619-94800
w3c xhtml validator w3c css validator