Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ATG32
Systematic Name YIL146C
Alias ECM37
Strain S288c
Description Mitochondrial-anchored transmembrane receptor that interacts with the autophagy adaptor protein, Atg11p, and is essential for mitophagy, the selective vacuolar degradation of mitochondria in response to starvation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ATG32 YIL146C
ATGGTGGACGAACTGTTTGTTAATACAAGGCTACAAATGATGCCTATTGTAAGAAACAAT
AATGGACTGGCTCTGAGTAGTAGAAACAAATATCTTTGTCCAGAGTCTTTAAAGATCTCT
GAAAACCTTTACCGCGGGCTGAAAGCTGCGGAAAATGCTATTAGGAGACTAGCACCAGGG
GGACGTCTCTCCAGATCAGAAATCATCGATACTGTGACTCAAATATGGGCACCCTACGTT
GATTCCCACGATTTCAAAATCGACTATGTTTCCTTAGCAGATTTTAAGACTCTTGATGAA
CTCTCCGATGTTGAAAACACCAGCGAACAGCAGCCAATAGTCATTAGTTGTGCTGTATAC
GTGACTGACCGCGAAAAACCCGATACGGTCGTCAGACTAATAGATAACATCGTTATTTAA
ACTAGGTGATTGGGCCTTCCCGTGTCTGTGTTGCAGTATATACCACTCTTATACAGTATG
CACGATATTCTTTTAAACCAACAACGGGATGATAGATTTCACGCTTGATGACTTTTTTTT
TAGACGGCTGAAGGGACGACATCCCCATCGCTCAAAACACAAATATGGAAAGGACAAATC
GTCTTTCACAGTTTGCATAGTAAAAGCAAAGTTTATACTACTTCAGCAAAGTTGAAGTTG
TTTGGCACTTGTTTCGTGCTTTCTCAAATATCTTAGATCACCGTCTGTCTAGAGCATATA
TCTATTGTTTGACGCACCCCTTTTACAAAAAAAAAAAAAAGAAACAGATCTATTAAGTAA
TAAAAAAGTTATTTAGGAAATAAGGTGCAGTAAGCTTCCTGAGGCATAATCATTATACTT
TTAAAATCTATATTTTTGGGTTATTGTTGAAATATTTTCTTACAAAGCCCATTTCTCGTT
TTTGACAATTTTTCTTATCAGTTGTGACTTCTCTTATCGATAAGCAATATTGAAGTCCTA
ATCACAAAAGCAAAAAAAATCTGCCAGGAACAGTAAACAT
Chr coordinates Chr IX from 75773-74184
w3c xhtml validator w3c css validator