Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPL40A
Systematic Name YIL148W
Alias CEP52A, eL40, L40A, L40e, UB11, UBI1
Strain S288c
Description Ubiquitin-ribosomal 60S subunit protein L40A fusion protein; cleaved to yield ubiquitin and ribosomal protein L40A; ubiquitin may facilitate assembly of the ribosomal protein into ribosomes; homologous to mammalian ribosomal protein L40, no bacterial homolog; RPL40A has a paralog, RPL40B, that arose from the whole genome duplication; relative distribution to the nucleus increases upon DNA replication stress
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL40A YIL148W
TCGTTTTTCGTCATTTACTTCTCTCATAGCTTCATGGCTCACATGCAATTGTTTTTTTAG
TGCATCTATTTCCCGCCTATATCTGGAACGTTCTTCATTCAGCTGATCTTTCAAGCCATT
CAATTCTTCTTTAGCTGTGTTCTTCTGCTCAGAAGATTCATCTAGTAGCTGCTTAAGTTT
TGAAATCCTTGAATAGTACTGCGATTTGATCTCATCGACCAAAACATTGAGTTTTGTCAC
TTCCTCTTCAGAACGTTCAAACTTGGCTATTTTCTTGTATAACTTTCTTAAGACAGGATA
GGTAACACCTTGAAGTGATTCGAATGGAACATTTAAAAACTCAGATATTTTGTCCTCCAT
TGCCGGTTTGCTTCCGCCCAGTGTTCTTTCGCCTTAAATTTCTTTTGGTAAACTTCCACT
AGAAAAAGAAAAGCCACCAGAGAAATAAGCGCTTGCAATTTAACGCCGATATTGTTTTCT
TCTTCTATTATCTTCAATTATCGATCAACTCTATCCAACAATTCTATAATATCCACTGTT
CATTAACGAATATTGGTCTTTTTCCCTTATGGTGAAGTAAATTTTCCATGCAATATCCGG
GTAAGCTATCGACAAGTTTATTGACTGCAATTTGAGTTTATTACATCCGTACATTACTAA
GATGTATGGTTTTTCTATTTTTGTGCTCCGTGTCGATATTTCGTGGAGCAAACCAGAAAA
GATGCGGAACCTCTTAGCACTCCGCCTGGACATAGGCGGAGCATATTCCTCCTATGGGAT
GGGTTTTGTTGTACTCTTTTCTCTCTAGACAGGACCTCCGATTGCCTCCCTGAGGGTGAG
ATGGTTTCCGGCCTCAGGACGGCCTTCTCCAGTTTCTAGCGAGGCATACATTCCAACCAA
AGGTGTATCAAGAATATCTGAAATTAAAGGTAGTTGAATCTCTATTTGTTGTTGTTATTA
CCGCTTATTATCCCATAGTTGAGACGACCAAGATTCAAAC
Chr coordinates Chr IX from 68708-68715,69150-69528
w3c xhtml validator w3c css validator