Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RRD1
Systematic Name YIL153W
Alias YPA1
Strain S288c
Description Peptidyl-prolyl cis/trans-isomerase; activator of the phosphotyrosyl phosphatase activity of PP2A; involved in G1 phase progression, microtubule dynamics, bud morphogenesis and DNA repair; required for rapid reduction of Sgs1p levels in response to rapamycin; subunit of the Tap42p-Sit4p-Rrd1p complex
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>RRD1 YIL153W
ATGTCTCTGGATCGTGTAGATTGGCCGCACGCCACCTTCTCTACGCCGGTGAAGCGTATC
TTCGATACGCAGACAACGCTGGACTTCCAATCGTCACTAGCCATTCACAGAATCAAGTAT
CATCTTCACAAGTACACTACGTTGATATCGCACTGTTCTGACCCCGACCCGCACGCTACT
GCGTCGTCGATCGCCATGGTTAACGGGCTGATGGGAGTGTTGGACAAGCTGGCACACCTG
ATCGACGAGACACCGCCTCTTCCAGGTCCTAGAAGGTATGGTAACCTAGCATGCCGCGAG
TGGCATCACAAGCTGGATGAACGTTTGCCTCAGTGGCTGCAGGAAATGCTTCCCTCGGAA
TACCATGAGGTGGTGCCTGAATTGCAGTATTACCTGGGCAACAGCTTTGGTTCGTCGACA
AGATTGGACTACGGCACGGGCCACGAACTTTCGTTCATGGCCACGGTCGCAGCACTGGAC
ATGCTGGGGATGTTTCCGCACATGAGGGGGGCAGACGTTTTTCTGCTGTTCAACAAGTAC
TACACGATCATGAGGAGGCTGATCCTGACGTATACGCTGGAGCCCGCTGGGTCACATGGC
GTGTGGGGGCTTGATGACCATTTCCACTTGGTGTACATCTTGGGCTCGTCTCAATGGCAG
CTGCTTGATGCGCAAGCACCCTTGCAACCAAGAGAAATACTGGATAAGTCTCTGGTGCGC
GAGTATAAGGACACCAACTTCTACTGCCAAGGCATAAACTTTATTAATGAGGTGAAAATG
GGGCCCTTTGAAGAGCATTCCCCCATCCTATACGATATTGCCGTCACCGTTCCACGCTGG
TCCAAAGTGTGTAAGGGGCTTCTAAAAATGTATTCTGTAGAGGTTCTGAAGAAGTTCCCC
GTGGTGCAACATTTCTGGTTCGGCACAGGCTTCTTTCCCTGGGTCAACATTCAAAACGGC
ACTGATCTTCCAGTCTTTGAAGAAAAGGAGGAAGAGAGTATAGAACAGGCTAACGCAGGA
TCGCCCGGTCGAGAACAGACTTCAACACGATTCCCAACGTCCACGTCAATGCCTCCCCCA
GGCGTTCCGCCGTCAGGTAACAATATCAACTATTTACTAAGCCATCAAAACCAGTCGCAC
CGGAACCAGACTTCTTTTTCAAGAGATAGACTACGTAGATAA
Promoter Sequence
Download FASTA
>RRD1 YIL153W
GCGACGCAGTCAAACAGGTGCATGACGTGCTTTCTGATTCTGGCAACGTTGGCGAACATC
TGGGAGTCGTCCGTGGGCTTCGAGGGCTCCCAGTGGACAATGTAGACGGTGTCTCCCTGG
TTGACAGCTGCGCCCATGAGATAGGTCAGGGCGTAGGTGGACTCGCTGCTCAGGTCCGTG
TAGAGGATGAAGGACCTTTGGTTCCCGGCCTCTGCGCCGGCACCCTTGGTGAGTAGTTGC
ATGGCTCTGACGTAGCCTCCGTCGAGTTGCTCCAGAGACACGTCTTCGTTTTCGTGGCCA
CGGATGCTGATCTCGTACTTGGCTATCCAGGGCTTGCTGGAGTCTAGCACTTCGTTTATG
CTGGTACAAAAGTTGGGTAACACTTTCATGCCCAGATCGTAGTGGAACTCCTCGTCAATC
TCTAAATCGTTCTCTATATCGCTCACTTGCTCTTCATCGGACTCTTCCTCGTCCATATCG
TCGCCGTCGCCGTCGTCGTCATCTTCGTCGTTGCCCTCACCTTCCTCTTCAGAATCCACA
TCCACGACCCTCAACCGCATCGAGGGGTCCTGCCTCAACACGGTCCACTTGAGGAACTCT
TCCTCCCTTACTCTGCTGCGGCTACTGGCCCTGCTTCTCGACCGCGACAGACTGCTCACG
TTTGAGTCTCGTTCGCCTCTTTTCTTCTTGCTACGACCTCTTTCCCTGTGGCCCCTTTCC
ATCTGCTCCGAGTCGAACTCCACCGTGGTGGGCGTTTCCGTTTTGATGCTGTGTAGATTC
GATTGTGTTCCGTCAGGTTTAGTCAGCAATATGCTCTTCTGCATTGCGTACTTGGTTGTT
TCTCTTGTTGGTTCTTTTGGTACTCACCCTTTCCATAGTCTCTTGTGTTTGATCAAGCCT
TTTTTCCGGACCTTTAAAGCTTTCTTAAAAAGATAAAATAGGAAGAAAGTGCAAAGTGCA
AAAGAACGCACATATGAACAAGCATTAAACGAGCAAAGAA
Chr coordinates Chr IX from 55198-56379
w3c xhtml validator w3c css validator