Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name POT1
Systematic Name YIL160C
Alias FOX3, POX3
Strain S288c
Description 3-ketoacyl-CoA thiolase with broad chain length specificity, cleaves 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA during beta-oxidation of fatty acids
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>POT1 YIL160C
AGAAAAAGTTGCAAAAAGCTTTGCTTTCGCAGGAATTTTTCTAGTTTATATAGAGCCTTC
GATAACTTCATGCCACCTGTTGAAAGGTTTCTAACTAGGCCATCCAAAAAGTGTGCGTTT
TCAGCTAGTTCATTAGTGGCCAAATGTGTAGAGTATGTCGTGCTCGAAGTCACTTTCTTT
TTCCCCCAATGATTGGAACTACGGATTTTACATATCAATAACCATTTCCTTCGTAGAGAG
ATGTTTTGTAAATTCTTATAAGCAGCCCCCCAAAAAAAAGTTCCATCTTTTAAAAGCTCA
TCAAACATTCTTTCGACGAGTGATGCGTCCTGAGGCATGCACTTCGGATTAAAATCCATT
TCCGATCCGTTCACTTCTTCGGAAACCATTGGTGACGAAGAAACGTCATTAGCTGAGAAA
TTCTTCTGTTTCATGTATATATGTGATCCTGTACCTTGTTTCTCTAACGCTACACCGACC
AACTGCAAGCCAGCGGCAACCAGCCCATCGTTCAAATTCAATTCTTCCAATTTACGGGCT
TCGCTGACCCTATCACGCGCGTGAAGTGACAGCGATCTGCGAGGGTAGCGGTACGTCTTC
TTGTTCGGGGAAGAGTCCATCGCTGATGATTGTGCTATTTTTTTATCTGCTTTTGTGTCA
CGATCATCATCACTATGTAATCTTCAAAAGATCAAGAATTTGCTAGTTTTGAACCTATGC
CACAAATAGCGAAAAAAGAAAAAAAACTTGACGCGTCAACATGAGGAGGGTAATGATGTG
GTAGCGCCGTGTAAGGCGCTATCAAAGGGAAACGGGGATAATAGTATTAACACCGCAGCT
TTTTTTTCCTTTCTCCCTCTATTGGTTTCAAATTTATTGGAGTTTTACTAGAAAGAAGAG
ATATAAATAGGGTATACTTTTGCATCTCAGTTCTATTGAAATCGAATGGTTATTTCTTGT
GGCTCTGAGTACAGAGTGAATATAACACTACATAAAAGCA
Chr coordinates Chr IX from 41444-40191
w3c xhtml validator w3c css validator