Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NIT1
Systematic Name YIL164C
Strain S288c
Description Nitrilase; member of the nitrilase branch of the nitrilase superfamily; in closely related species and other S. cerevisiae strain backgrounds YIL164C and adjacent ORF, YIL165C, likely constitute a single ORF encoding a nitrilase gene
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NIT1 YIL164C
CCCGCACCCCGTAGTCACGTTCGCCTTCGCAGCTTTTTAAAAATGGCAAAGAGTCTGACT
TATGCTCTGTTGACATTTAAGAGATACAATGAATCGATCCAACAATTATTAGCCATCAGT
ACTTCTCTTTTGTGAGGTAGGGCGACAAGAAAACGCACAAACTAGAGAAGATATTTATGC
ATTTTTCGGTATATCAGATAAAAGTTGGTAGTGCTCGAGCTTTTCTTTCTATACCAATAA
ATGCTGCAAAATATTATAATCTAATTAGTACTGAAGTAACTCTAGCAAAGCACAGGTGAC
AAAATTTGTGCTGGTGATTGTTGGTACTGCTATCGCCAGAATAGTCGAGATGTTTGCATG
TATCGACTGCTATGCGCGTAAGAAATTGGAATTTTGTATGGATAACTATGGCCGACCACT
GCACCTAGCAACAGTGAAGAACTCGTTTATCGAGAGACGAGTGTCGAGATAACAGATATG
ACAATTAGATTATGTAGCCGAAACCATATATTAGAGCCAGTAGTTGTTTGATCATAGCTT
GATTTTCATTAATTATCAGTCCTCTTCCGTGTAGTGCCTTTTTTCTTCTGCAAGCGAACT
TTTTACAGATGGAAGTTCGATAACAGAGGAAAAAGGCGAAAGGTGGTTACTTGAAACATG
GTGTATCTTAAAAACCGCTCGAAATTATAGAGGTGAAATTACAAGTTACTTGCGGTTCGA
TAAGCAAACGCATTTACGCTTATACTTTGGAGCCACATTTCACTATGAACGCCACATTAT
ATTAATCCCACCGCGATTTGAAAACGGTTATCAGTAAAGTTGGCCTAATGCTTACGAAAT
ATGAGCTATCTTTTTTGCTTCGTAAAAAAAATGGAGCCCAGGCCTCCGTGACTCATAAAG
GGCAGTGTATATAAATAATAAAAGCTCTTCAATAAGAAAGGGTGATATTATGACTTAGGG
TTAGCCAATCACTTTTCGAGGCTACCTCTAGTTAACCACA
Chr coordinates Chr IX from 34686-34087
w3c xhtml validator w3c css validator