Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YIL165C
Systematic Name YIL165C
Strain S288c
Description Putative protein of unknown function; mutant exhibits mitophagy defects; in closely related species and other S. cerevisiae strain backgrounds YIL165C and adjacent ORF, YIL164C, likely constitute a single ORF encoding a nitrilase gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YIL165C YIL165C
TGGAAGTTCGATAACAGAGGAAAAAGGCGAAAGGTGGTTACTTGAAACATGGTGTATCTT
AAAAACCGCTCGAAATTATAGAGGTGAAATTACAAGTTACTTGCGGTTCGATAAGCAAAC
GCATTTACGCTTATACTTTGGAGCCACATTTCACTATGAACGCCACATTATATTAATCCC
ACCGCGATTTGAAAACGGTTATCAGTAAAGTTGGCCTAATGCTTACGAAATATGAGCTAT
CTTTTTTGCTTCGTAAAAAAAATGGAGCCCAGGCCTCCGTGACTCATAAAGGGCAGTGTA
TATAAATAATAAAAGCTCTTCAATAAGAAAGGGTGATATTATGACTTAGGGTTAGCCAAT
CACTTTTCGAGGCTACCTCTAGTTAACCACAATGGCGAAACACATTGTTGCTGCCCTTCA
AATCGGCTCTTGTCCGGGCTCTACTAAGGATACCTTGAAAAAAATTTTGTCATATGAGAA
GGAGATCAAGGAATCTGGTGCCAAGTTGGTCGTTATCCCAGAAGCCACTCTTGGTGGTTA
TCCAAAGGGATCGAACTTTGGGGTTTATCTAGGCTACCGTCTTCAAGAAGGAAGGGAGGA
GTATGCTAAGTATCTTGCCGAAGCAATTGAGATCGGAAACGGAGAGAAATATCCAGAAAT
TAGTCAGTTGTGCGCACTATCGAAGGCCACCGACGCATCCTTATGTGTGGGGTGTATAGA
GCGCGATGGGACGACATTATATTGTACCATGGTTTATATAGATCCTAAAGATGGCTACGT
TGGGAAGCATCGAAAACTGATGCCGACAGCTGGCGAAAGACTGATATGGGGTCAAGGCGA
TGGTTCGACTCTGCCTGTCGTGGATACCGCTGCTGGGAAGATTGGCGGTGCTATCTGCTG
GGAGAACATGATGCCTCTACTGAGATACGCCATGTATAAAAAAGGGGTTGAGATCTGGTG
TGCCCCAACGGTGGATGCTAGGCCTATTTAGAGGACTGTG
Chr coordinates Chr IX from 34077-33718
w3c xhtml validator w3c css validator