Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SOA1
Systematic Name YIL166C
Strain S288c
Description Putative protein with similarity to the allantoate permease (Dal5p) subfamily of the major facilitator superfamily; mRNA expression is elevated by sulfur limitation; YIL166C is a non-essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SOA1 YIL166C
GTCTCTAAGATATAATCCAAGCCATGATTTTGAAATCAGGATCGCAAACCTGATCATTTA
ATTTTTACCTTTTTTTAAAATATAAATTAACATTTATTAATAAATAGGTGTATTTGAGAA
GTTTCATTTTCGTTCAACAGCCCAGTTATCATCATTTCACAAACAAGAAGGAGATATTAG
CATTTTCTCCCGGATCCGATTAACACAGTTTTTTTGTTTAATCCGGTGTGAAGAAGATTT
ATAAATGTCGTGATATTTTTTAATGTGGAGATTGTACGATGACGGGTAGGAGTCAAGACA
AGCTAAAGAATGCAGCCTTAATAATTGCGCCTTTCACAATCAAAATTATGCATTGACCCG
ATACAAGAATCACCGTGTGGATCAAGCCATTCTTACCAAGCTTACTTTTGCCGTCGCCAA
GGCTGTTTGTAGTCATTCTCTGAACTTTTTTCCTTGGCATTCGGCTCGACGCAGAGAATT
TCGGATCGATATAATCCCGAAATAGTCCGTTTCTCGGATAATTGTGCCGAAATGCATCAT
ATTACAACGTACTATCTTGAATTGCTAGCATTCTCGTAAGAAAGAAAAACCTCGAGCAAA
TAGGCTACATTTGCTGCTGCACCCCTTTACAGCACAAAGTCGTTGCAGCTAGCTCCTTAA
AATAAGGACCCTGCAGTCATGTGGCATATATAATAGTTGGCGAAGCTTGAAGCCTCACTT
AGAGGTTGACGCCTCACTTGAGGTTTCAACATATACTGATGGTTTCATTTCAACAGCCTA
TGGGTCAATTGGGAATAACTATCAATGCTACCAATTTGTCACACTTTATTGCCTAATAGG
TTTGGCGCTTACTATCAAATACATGACGTATTCCCTGCGCTAGGTTCGTCTTCTACTGAA
TCATTTAGTATAAAAAGGCAGCGTTCAATTGTTGATTATTGAAATTATTTATTGTACAAA
CAATTAATAAAAAATTCAATCAACAAACAAAGTTTCATCT
Chr coordinates Chr IX from 32566-30938
w3c xhtml validator w3c css validator