Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CSS1
Systematic Name YIL169C
Alias HPF1'
Strain S288c
Description Putative protein of unknown function; serine/threonine rich and highly similar to YOL155C, a putative glucan alpha-1,4-glucosidase; transcript is induced in both high and low pH environments; YIL169C is a non-essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CSS1 YIL169C
CGCTAGAGAATTTTTTTCGGAAAGATTTGGAATATCGGCGCACGGAATTATGTTCCTTGC
TTTCTCTCGTGGATAGGTGCAAATAACGTTAAATAATATGATAATTCCAAGATCCATGAA
TCATGTTTGCAAATTGGGTGGCATTTCAAATTATTTTAGGAAAAAAATGGCAAAAGTTTC
TTTAGTTAGGTGCTTAATTTTTTTTGCCAAGGGACGAGTCTTGGGAGGAGTCCTAAACTT
TGTTTGATTATGAAAGCAACCCGGAAGGTGCGGTATTTTACAGGGAGTGGCTTTTGAAGG
GACTTACTAGCCACTCGCTAACGCAAAAATTATCGCGTTCGCGTCACAGTGAAGTCAGGC
AGCCGTCCCCTCAGCAATGTTGAAGATTCACTTCGCGACCAAGAGCAACCACCATTTTTT
TTTGCTCCAAAGGCGGGAGATGCCTATTTCTATCTTTTAATCGTATATGATCCTGTAGTG
AGTCCAAACGGCTCATTTTGAGTACGGATTACTGTAATTGCTCGTGTTGGATTGAGCGAA
AGTAGCGTAAGTCTCAAAAAAAAATTGGGTTACTACTCATAATACTCCTGGTTCTTTCTC
ATGAACCATTTTGGTCATAGCCTATTGGTTTGTGCCGTTCTGCACGTTTTCGTATAATAT
TAAAGGGATCGTGTTGTTATTCACGGCAACCATTGCGTTTGCATAAAATTACTACCCAAT
TTCCTACTTACCAAACGCGCGCGCATAGACCTCGCAGGCTTTGAAGAGTCCTGTGGAATT
GCCGTACAAAAAATCGATCTAGCTCAACAGTCCTTTCAGTAATTACATATCGGAAGCCCA
CAAATAACTGCAACAGCGCCTACAATGATATAAAAGGCTTTGTCTTGATTCATTGCTATG
GGGGGTTTTGGACAGTATGTGTTGTTTTTATTTCGAGTAAATTTAGAAACAGCAAGCCTC
ATCATTGCAAATTTGGTAAGATCTCGCCTAATTGAAAGAG
Chr coordinates Chr IX from 26106-23119
w3c xhtml validator w3c css validator