Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DJP1
Systematic Name YIR004W
Alias ICS1, PAS22
Strain S288c
Description Cytosolic J-domain-containing protein, required for peroxisomal protein import and involved in peroxisome assembly, homologous to E. coli DnaJ
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DJP1 YIR004W
CAGATTTTACGAGCAAATTGAATGGACTGTTTGCGCTACCTGGTATGGTGAACCCTGGAC
AGCTTCCACCTTCCTTGGAGAAGAAGTTGTCCTCCCCGGATACTGAATCTAAGCTAGGAC
CCCAGGACCAATCACAGGCAAAAACGGGACCTCTGGGCGGAACTAGAAGAGGTAGAGGAC
CTCGTGGGCGTAAATTACCTTCTAAAGTAGCTAGCGTAGAGAAGATTGAAGAAGATGACA
ACACTAATAAAATAGAAATATTTAACAATTGGAATGTTTCCTCTTCCTTCTCTAAGGAAA
AAGTCTTAATAGATACTACTCCTGGTGAGCAAGCAGAAAGGGCCTTGGATGAAAAGTCAA
AGAGCATTCCCGAGGAACAACGAGAACAATCTCCAAATAAGATGGAGGCTGCTCTTTGTC
CTTTTGAGCTGGACGAAAAGGAAAAGTTACCTGCTAATGCTGAGTCGGATCCTCTTTCTC
AGTTGCCACAGACGAACGCCGTAGGTAATAGAAAAGCCATAAGTGAGGAATCTCTGTCCC
CATCGGAGGCCATCGCCAACAGAGATCAAAACGATACGACAGAAATACAGGAACAGCAGA
TGGAGGACCAAATGGAGGTTGATATGGAAAGAGAACTCTCAGGTGGCTACGAAGACGTTG
ATTCTGCCTTACATTCAGAAGAAGCGTCTTTTCACTCCCTTTAGAATCTTATAAATAATA
TGTATGAATAAACTCTATAGTATGTATCAAGAGAGAAATATGTGAATGACGAGCAAACTA
GAGGTGTTATTAATAATAATGGCATAAAAACTAGATTTTATTCTATATATATATATATAT
ATTTCTTCGACTTTTTTTTTTTTTACCCGCACACCCTGAATTTTGTGCTATTTTGAAGCA
GAGCGTACTGAACAAATTGGCAGATTTACAAGAGGAATAACAGAGTTATGCTAAATCATT
AAGTGTTTCTTGCGGCCAGAAGGGGCATTATACAAAAGAT
Chr coordinates Chr IX from 363221-364519
w3c xhtml validator w3c css validator