Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DJP1
Systematic Name YIR004W
Alias ICS1, PAS22
Strain S288c
Description Cytosolic J-domain-containing protein, required for peroxisomal protein import and involved in peroxisome assembly, homologous to E. coli DnaJ
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>DJP1 YIR004W
ATGGTTGTTGATACTGAGTATTACGATTTGTTAGGTGTGTCTACCACTGCATCTTCCATT
GAAATAAAAAAGGCCTATAGAAAGAAATCTATTCAAGAGCATCCTGATAAGAATCCCAAT
GACCCCACGGCTACCGAAAGGTTTCAAGCAATATCCGAAGCTTATCAAGTTTTAGGTGAC
GATGATCTTCGCGCAAAGTATGATAAGTATGGAAGAAAAGAAGCTATTCCTCAGGGCGGC
TTTGAAGATGCAGCTGAACAGTTCTCTGTCATCTTTGGTGGAGATGCGTTTGCCTCATAT
ATTGGCGAACTGATGCTATTAAAGAACCTACAGAAAACTGAGGAGCTAAATGCTGAAGAC
GAAGCTGAAAAGGAGAAGGAGAATGTGGAAACAATGGAAGAATCACCTGCAGACGGTAAG
ACGAATGGCACCACTAACGCTGTTGATGCAGCATTGGGCAATACTAACGAAAAAGATGAC
AAAAATAAGGCGAGGACAACTTCTGGTAATTTAACTGTACACGATGGAAACAAGAAAAAT
GAGCAGGTAGGAGCAGAAGCTAAGAAGAAGAAGACAAAATTAGAGCAGTTTGAGGAAGAA
CAAGAGGTAGAAAAGCAAAAAAGAGTAGACCAATTAAGCAAAACATTGATTGAAAGATTA
TCGATATTAACAGAAAGTGTCTATGATGATGCATGTAAAGATTCCTTTAAAAAAAAGTTC
GAAGAGGAAGCCAATCTTTTAAAGATGGAATCATTTGGTCTGGACATATTACACACAATA
GGCGACGTTTACTACGAAAAAGCTGAAATTTTTCTTGCATCCCAGAACCTGTTCGGAATG
GGTGGTATATTTCATTCTATGAAGGCTAAAGGGGGAGTATTTATGGATACACTAAGAACT
GTTTCGGCAGCCATAGACGCTCAGAATACTATGAAGGAGCTTGAAAAAATGAAAGAAGCT
AGCACGAATAATGAGCCTTTGTTTGACAAAGACGGAAATGAGCAAATTAAGCCAACCACT
GAGGAACTGGCGCAGCAAGAGCAGCTATTGATGGGCAAAGTATTGTCGGCTGCTTGGCAT
GGTTCTAAATATGAAATAACATCCACTTTACGTGGCGTTTGTAAAAAAGTACTAGAAGAT
GACTCGGTAAGTAAGAAAACGCTTATCAGAAGAGCTGAAGCAATGAAACTATTGGGTGAA
GTCTTTAAGAAAACTTTCAGAACCAAAGTCGAACAAGAAGAGGCACAGATCTTTGAAGAA
CTTGTAGCAGAAGCTACAAAAAAGAAGAGACATACATGA
Promoter Sequence
Download FASTA
>DJP1 YIR004W
CAGATTTTACGAGCAAATTGAATGGACTGTTTGCGCTACCTGGTATGGTGAACCCTGGAC
AGCTTCCACCTTCCTTGGAGAAGAAGTTGTCCTCCCCGGATACTGAATCTAAGCTAGGAC
CCCAGGACCAATCACAGGCAAAAACGGGACCTCTGGGCGGAACTAGAAGAGGTAGAGGAC
CTCGTGGGCGTAAATTACCTTCTAAAGTAGCTAGCGTAGAGAAGATTGAAGAAGATGACA
ACACTAATAAAATAGAAATATTTAACAATTGGAATGTTTCCTCTTCCTTCTCTAAGGAAA
AAGTCTTAATAGATACTACTCCTGGTGAGCAAGCAGAAAGGGCCTTGGATGAAAAGTCAA
AGAGCATTCCCGAGGAACAACGAGAACAATCTCCAAATAAGATGGAGGCTGCTCTTTGTC
CTTTTGAGCTGGACGAAAAGGAAAAGTTACCTGCTAATGCTGAGTCGGATCCTCTTTCTC
AGTTGCCACAGACGAACGCCGTAGGTAATAGAAAAGCCATAAGTGAGGAATCTCTGTCCC
CATCGGAGGCCATCGCCAACAGAGATCAAAACGATACGACAGAAATACAGGAACAGCAGA
TGGAGGACCAAATGGAGGTTGATATGGAAAGAGAACTCTCAGGTGGCTACGAAGACGTTG
ATTCTGCCTTACATTCAGAAGAAGCGTCTTTTCACTCCCTTTAGAATCTTATAAATAATA
TGTATGAATAAACTCTATAGTATGTATCAAGAGAGAAATATGTGAATGACGAGCAAACTA
GAGGTGTTATTAATAATAATGGCATAAAAACTAGATTTTATTCTATATATATATATATAT
ATTTCTTCGACTTTTTTTTTTTTTACCCGCACACCCTGAATTTTGTGCTATTTTGAAGCA
GAGCGTACTGAACAAATTGGCAGATTTACAAGAGGAATAACAGAGTTATGCTAAATCATT
AAGTGTTTCTTGCGGCCAGAAGGGGCATTATACAAAAGAT
Chr coordinates Chr IX from 363221-364519
w3c xhtml validator w3c css validator