Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name EGH1
Systematic Name YIR007W
Alias hydrolase
Strain S288c
Description Putative protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm; YIR007W is a non-essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>EGH1 YIR007W
AATTACCAAAACTTTGAGGCATCCCACCAATTCCGGTAGCCTGAGGCTGGTTAAACGCCA
TTTGCTGTTGTGGTTGAGGCTGGCCTTGGGGCTGGTTTGAAGACTGACCTTGCTGCTGCT
GCGGGTAGAATCCATTTGGTTGTTGCTGCTGTTGCTGCTGTTGCTGCTGGTAACCCATGC
CCTGTTGCTGGTACGGGTTATACATATTCAGTTGTACAGATTAGCAATTTCGCGTCGCTG
ATAGATTCTTCCTCTTCCTGCTTCTCGACGTGTGTTTCGCCAATAGATCTATATGGCTTT
CTAATGCTTTTTTTCTTCCAATACCAACTTTTGCCCCTAACAAGAAAAAAATATCGTCGA
CGTGTCATGTGATCAAGCCAATTTATAATAACAAGCGATTGATAAACAGAGTATACATAG
CTACTATGCGACTGAGAGATCAATCGGTTATCGTGAGCACCTACCTTTAAGGTTTAACAG
ATCTGGACGTGATTTTTTTTTTTTTTTTTTGACGAACCAGATTGTCAAATAAACATTGTT
AATTGATGAATTTTTAATATCTGCCCAATTGAAGCATAAAAAGCGTCTTAGGAAAGCATT
CGTTAAATATCTCTACTGTTGGTAAGCAGGTACTTCAGTAAAAAACCATATTAAACCCAA
AATTATCAAATTAGTAGTACATAAGATCGAAGTAGAAAAAATATAGATTATAATCCGATA
TAGTGTAACGGCTATCACATCACGCTTTCACCGTGGAGACCGGGGTTCGACTCCCCGTAT
CGGAGTATGTTTATTTTATTTTTTTCATATCCGCTCGAATATTGCCTTCGTTTAAGGTTT
CTATATCTCTGGTAAACCTTAACAATGGAATTAATATTAATTCTATATTTCGCAATAATT
CTACTGACAGTTATTTTCTTAACCTTTCTTCTCTTTTTTTATTTATTTATTTCTTTTTCT
TTCGTACCTAAATTGTTTGAATTTAATAAGAACAGATCAT
Chr coordinates Chr IX from 370704-372998
w3c xhtml validator w3c css validator