Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name YAP5
Systematic Name YIR018W
Strain S288c
Description Basic leucine zipper (bZIP) transcription factor
External source Open in SGD external link
Orthologs
Candida glabrata CBS138CAGL0K08756g/AP5
Zygosaccharomyces bailii IST302ZBIST_3801/ZbYAP5
Kluyveromyces lactis NRRL Y-1140KLLA0_D14399g
Yarrowia lipolytica CLIB122YALI0_B13200g, YALI0_E11693g
Kluyveromyces marxianus DMKU3-1042KLMA_50410
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YAP5 YIR018W
TCTCGTTAATGTCATTGAGCTTTGCTTTCCAAAACTCATTTTCCTTGTTCAATTGCTCTA
TACGATCGCGAAGTTTGTTGATTTGCGTGTTTAAGTTCTGCAGCTTATTCATGTTCTCAA
AATTCTTTTGTTTCTTGCGAATGCGGAACCGCTGCGACGCCTCTGTGTTCTTTCTTCTCC
GCTCTTGCTTAATCTTATCCAGTTCGTTAGAAGTGCTCACGGGAGCTTCCTCTTCTTTTA
CAACAACTGCTGTTGTTGCGGCAACCTTCCCCTTTCTCGGCTCGCGGAGCTTCTTAAACT
GCGAGACATCCTGGCCATTATTTATCATGCTAATGAGCTCCTCCGCGTTGCCACTGCTAA
CCAGCAGCAATGATAGCAAGCGCGAGCCCAGCTCTGAATCGCTTGATATCAGGTTCTGTA
GATGTTCCGAAAGATTGTTCACGTTCATACCCTTCCTGCTTGCAATGTCAATGTTTGTTG
ATTTCTTTTCCCACCCTTGTTTCGCACTCATATTGACGAACAAAACAATTTGTCTTCGTA
ACTACCACTGGTTATAAATAGTTAAATTCAAGTTACCTCGTGTTCTTAGTCATTGGCTGC
CCGGCCTTGACTCACGCCAGTGACCTACAACTATGGCGTTTCCGCTTCCCGCCCAAAACT
GTGGTGTTAGAAAGTAGAAAAAGGTGAAAAAAGCGAAACCTAAAACCAAAAAAAAAAAAT
AAGTCACGTGCACTCAGTACCCCTTCTATTGTATTTTAGTTTACCTATTGGGCCGGGCGG
GCCCCACAACTGTGGCATCTTTCAGATCATTTTTTTCCAGAATGCATGGAACTGACGAGT
GAACTTTTATTCCACGGAAAAGGACAAAAAGGTGCAGTAATGGAATGGTCTTTTTGCACG
GCAGTGATGTCGCTATCATATCAATCACTGAAAGTGAAGTTAACCATATTACAACAAGTT
CACACAACATAAACAGTGTAACTAGCATATTATCACAGTC
Chr coordinates Chr IX from 384609-385346
w3c xhtml validator w3c css validator