Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FLO11
Systematic Name YIR019C
Alias MUC1, STA4
Strain S288c
Description GPI-anchored cell surface glycoprotein (flocculin) required for pseudohyphal formation, invasive growth, flocculation, and biofilms; transcriptionally regulated by the MAPK pathway (via Ste12p and Tec1p) and the cAMP pathway (via Flo8p)
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FLO11 YIR019C
TTCCCTTTTCTTTTTCTTTGTTGCGACAGTGGCTTCAAAGAACTGCTGATTGCTCAAGGC
AATCAGTCCGAGCGTTTAGAAGGTGATTGTAGGCAGAAATTAACTTTGCGGTAAAAGAAT
GACATTCTTTCTTAAAAGAAAAATTAGCTTTTTTTTGTCAGGCATTGCACAAACTTTTTT
ATTTCTGCCTATACTCTTAAACAGATCAGTCATTCATGTTGTCTTTTTAACGGTCGTACT
GGGACATCGCATACCTTGGGATTCCGTAATTAGGTGCAACAATACGGGCACAACTCATTC
TGCGGTATCTTCACGGACAGAACTTCTATTGCCTATCGGTGGTGTGATTAACAATTGGAA
GCGCAGAGCTTGGAATGGATTTTCAATTCAATGGATTTGGAGGTATTCGTTTGTTTACTA
ATATTTACTTTGAGGACATTGCCCAACCCTAAAAGTGCCTGCTCAAGAATAGAATAACAT
TATGATACGTTTTCTTGACCGCTGAGCAATTTAAAGCAACTATTAGGGTACGATTGTTTC
TAGAGAAATGTGGGTCATCTTTTTAGGTCCGTTCTCTTCTGATGAGGTAACCTTTACAAA
AATGTCATAGAGTTACCAATTGGGATTCAAGGCATCATCGCAATATACTTCGTTCTTTTA
CGGAGAAATTAAGCTCTTTCTACTTTGAATTAACTGTTAGACTTGTCTTATCTGAGGAAT
GTCCGTGTTCGAATTAAATAAAAAATTAGGGCAGTTTTATTTACCTTAACAAATATGTTC
AAGCATTTACGTTACTGCGCTCTCTTCTAGTTCAAGAACGGATAACTCATAGACTTACCA
GTACAAATTGTTGAAGGGTTCCCAATTGATAAAAAGGATCTCTTGCTTCCTAAAATAAAC
GTATAAAAAGCACCCTATTCATCAGTTATTATCCCTCGTCATGTTGTGGTTCTAATTAAA
ATATACTTTTGTAGGCCTCAAAAATCCATATACGCACACT
Chr coordinates Chr IX from 393675-389572
w3c xhtml validator w3c css validator