Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FLO11
Systematic Name YIR019C
Alias MUC1, STA4
Strain S288c
Description GPI-anchored cell surface glycoprotein (flocculin) required for pseudohyphal formation, invasive growth, flocculation, and biofilms; transcriptionally regulated by the MAPK pathway (via Ste12p and Tec1p) and the cAMP pathway (via Flo8p)
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>FLO11 YIR019C
ATGCAAAGACCATTTCTACTCGCTTATTTGGTCCTTTCGCTTCTATTTAACTCGGCTTTG
GGTTTTCCAACTGCACTAGTTCCAAGAGGATCCTCCGAAGGAACTAGCTGTAATTCTATC
GTTAATGGCTGTCCCAACTTAGACTTCAATTGGCACATGGACCAGCAAAATATCATGCAG
TATACTTTGGATGTGACTTCCGTTTCTTGGGTTCAAGACAACACATACCAAATCACTATT
CATGTCAAAGGTAAAGAAAATATTGACCTGAAGTATCTATGGTCTTTGAAAATCATTGGT
GTCACTGGTCCAAAAGGTACCGTCCAACTATACGGTTACAACGAAAATACCTATTTGATT
GACAACCCAACTGATTTCACAGCCACTTTTGAAGTTTATGCCACACAAGATGTCAACAGC
TGTCAGGTGTGGATGCCTAACTTCCAAATTCAATTCGAGTATTTGCAAGGTAGTGCCGCT
CAATATGCAAGCTCCTGGCAATGGGGAACTACATCTTTTGATTTGTCTACTGGTTGTAAC
AACTATGACAATCAAGGCCACTCTCAAACGGATTTCCCAGGCTTCTATTGGAACATAGAT
TGTGACAATAATTGTGGCGGTACGAAGTCATCTACCACTACATCTAGCACTTCCGAGTCA
TCTACCACTACATCTAGCACTTCCGAGTCATCTACCACTACATCTAGCACTTCCGAGTCA
TCTACCACTACATCTAGCACTTCCGAGTCATCTACATCATCATCAACCACCGCTCCTGCT
ACACCAACCACTACCTCATGCACTAAGGAAAAGCCTACACCCCCAACCACTACCTCATGC
ACAAAGGAAAAGCCTACACCTCCTCATCACGACACCACTCCATGTACAAAGAAGAAAACT
ACCACATCTAAGACATGCACTAAGAAGACTACTACTCCAGTACCAACCCCATCAAGCTCT
ACTACTGAAAGTTCTTCTGCTCCAGTACCAACTCCATCCAGCTCTACTACTGAAAGCTCT
TCTGCTCCAGTAACCAGCTCTACCACTGAAAGCTCTTCTGCTCCAGTACCAACCCCATCA
AGCTCTACTACTGAAAGCTCTTCTGCTCCAGTAACCAGCTCTACCACTGAAAGCTCTTCT
GCTCCAGTAACCAGCTCTACCACTGAAAGCTCTTCTGCTCCAGTACCAACTCCATCCAGC
TCTACTACTGAAAGCTCTTCTGCTCCAGTAACCAGCTCTACCACTGAAAGCTCTTCTGCT
CCAGTAACCAGCTCTACCACTGAAAGCTCTTCTGCTCCAGTAACCAGCTCTACCACTGAA
AGCTCTTCTGCTCCAGTAACCAGCTCTACCACTGAAAGCTCTTCTGCTCCAGTACCAACT
CCATCCAGCTCTACTACTGAAAGCTCTTCTGCTCCAGTAACCAGCTCTACCACTGAAAGC
TCTTCTGCTCCAGTACCAACTCCATCCAGCTCTACTACTGAAAGCTCTTCTGCTCCAGTA
ACCAGCTCTACCACTGAAAGCTCTTCTGCTCCAGTACCAACTCCATCCAGCTCTACTACT
GAAAGCTCTTCTGCTCCAGCTCCAACCCCATCAAGCTCCACCACTGAAAGCTCTTCTGCT
CCAGTAACCAGCTCTACCACTGAAAGCTCTTCTGCTCCAGTACCAACTCCATCCAGCTCT
ACTACTGAAAGCTCTTCTACTCCAGTAACCAGCTCCACCACTGAAAGCTCTTCTGCTCCA
GTGCCAACTCCATCAAGCTCTACTACTGAAAGCTCTTCTGCTCCAGTACCAACTCCATCA
AGCTCTACTACTGAAAGCTCTTCTGCTCCAGCTCCAACCCCATCAAGCTCTACTACTGAA
AGCTCTTCTGCTCCAGTAACCAGCTCTACCACTGAAAGCTCTTCTGCTCCAGTACCAACT
CCATCCAGCTCTACTACTGAAAGCTCTTCTGCTCCAGTACCAACCCCATCCAGCTCTACT
ACTGAAAGCTCTTCTGCTCCAGTACCAACTCCATCCAGCTCTACTACTGAAAGCTCTTCT
GCTCCAGTAACCAGCTCTACCACTGAAAGCTCTTCTGCTCCAGTAACCAGCTCTACCACT
GAAAGCTCTTCTGCTCCAGTACCAACTCCATCCAGCTCTACTACTGAAAGCTCTTCTGCT
CCAGTACCAACTCCATCCAGCTCTACTACTGAAAGCTCTTCTGCTCCAGTACCAACTCCA
TCCAGCTCTACTACTGAAAGCTCTTCTGCTCCAGTAACCAGCTCTACCACTGAAAGCTCT
TCTGCTCCAGTACCAACTCCATCCAGCTCTACTACTGAAAGCTCTTCTGCTCCAGTGCCA
ACTCCATCCAGCTCTACTACCGAAAGCTCTTCTGCTCCAGTACCAACCCCATCAAGCTCT
ACTACTGAAAGCTCTGTAGCACCAGTACCAACCCCATCTTCCTCTAGCAACATCACTTCC
TCCGCTCCATCTTCAACCCCATTCAGCTCTAGCACTGAAAGCTCTTCTGTTCCAGTACCA
ACCCCATCAAGCTCTACTACTGAAAGCTCTTCTGCTCCAGTATCCAGCTCCACCACTGAA
AGCTCTGTAGCACCAGTACCAACCCCATCTTCCTCTAGCAACATCACTTCCTCCGCTCCA
TCTTCAATTCCATTCAGCTCTACTACTGAAAGCTTTTCTACTGGCACTACTGTCACTCCA
TCATCATCCAAATACCCTGGCAGTCAAACAGAAACCTCTGTTTCTTCTACAACCGAAACT
ACCATTGTTCCAACTAAAACTACGACTTCTGTCACTACACCATCAACAACCACTATTACC
ACTACGGTTTGCTCTACAGGAACAAACTCTGCCGGTGAAACTACCTCTGGATGCTCTCCA
AAGACCGTTACAACTACTGTTCCAACTACAACTACGACTTCTGTCACTACATCATCAACA
ACCACTATTACTACTACAGTTTGCTCTACAGGAACAAACTCTGCCGGTGAAACTACCTCT
GGATGCTCTCCAAAGACCATTACAACTACTGTTCCATGTTCAACCAGTCCAAGCGAAACC
GCCTCGGAATCAACAACCACTTCACCTACCACACCTGTAACTACAGTTGTCTCAACCACC
GTCGTTACTACTGAGTATTCTACTAGTACAAAACCAGGTGGTGAAATTACAACTACATTT
GTCACCAAAAACATTCCAACCACTTACCTAACCACAATTGCTCCAACTCCATCAGTCACT
ACGGTTACCAATTTCACCCCAACCACTATTACTACTACGGTTTGCTCTACAGGTACAAAC
TCTGCCGGTGAAACTACCTCTGGATGCTCTCCAAAGACTGTCACAACCACTGTTCCTTGT
TCAACTGGTACTGGCGAATACACTACTGAAGCTACCACCCTTGTTACAACAGCTGTCACA
ACCACCGTTGTTACCACTGAATCCTCTACGGGTACTAACTCCGCTGGTAAGACGACAACT
GGTTACACAACAAAGTCTGTACCAACCACCTATGTAACCACTTTGGCTCCAAGTGCACCA
GTAACTCCTGCCACTAATGCCGTACCAACTACAATAACCACTACTGAATGTTCTGCTGCT
ACAAACGCTGCCGGTGAAACTACATCTGTATGCTCTGCTAAGACTATCGTAAGTTCTGCA
AGCGCAGGCGAAAACACTGCACCTTCGGCTACCACCCCTGTCACGACGGCTATTCCAACC
ACAGTTATTACCACTGAGTCATCTGTTGGTACTAACTCCGCTGGCGAAACAACAACTGGT
TACACAACCAAGTCCATCCCAACCACTTACATAACCACTTTGATTCCAGGTTCAAATGGT
GCCAAGAATTACGAAACTGTGGCCACAGCAACCAACCCTATTTCAATCAAGACTACATCC
CAACTAGCTACAACAGCTTCTGCTTCTAGCGTGGCTCCCGTTGTCACATCTCCATCTCTA
ACTGGTCCACTACAATCTGCTTCTGGTTCTGCAGTCGCTACATACTCTGTTCCTTCTATC
TCGAGTACTTACCAAGGTGCTGCTAATATCAAGGTTCTTGGAAACTTTATGTGGTTGCTA
CTCGCTCTTCCAGTTGTATTCTAA
Promoter Sequence
Download FASTA
>FLO11 YIR019C
TTCCCTTTTCTTTTTCTTTGTTGCGACAGTGGCTTCAAAGAACTGCTGATTGCTCAAGGC
AATCAGTCCGAGCGTTTAGAAGGTGATTGTAGGCAGAAATTAACTTTGCGGTAAAAGAAT
GACATTCTTTCTTAAAAGAAAAATTAGCTTTTTTTTGTCAGGCATTGCACAAACTTTTTT
ATTTCTGCCTATACTCTTAAACAGATCAGTCATTCATGTTGTCTTTTTAACGGTCGTACT
GGGACATCGCATACCTTGGGATTCCGTAATTAGGTGCAACAATACGGGCACAACTCATTC
TGCGGTATCTTCACGGACAGAACTTCTATTGCCTATCGGTGGTGTGATTAACAATTGGAA
GCGCAGAGCTTGGAATGGATTTTCAATTCAATGGATTTGGAGGTATTCGTTTGTTTACTA
ATATTTACTTTGAGGACATTGCCCAACCCTAAAAGTGCCTGCTCAAGAATAGAATAACAT
TATGATACGTTTTCTTGACCGCTGAGCAATTTAAAGCAACTATTAGGGTACGATTGTTTC
TAGAGAAATGTGGGTCATCTTTTTAGGTCCGTTCTCTTCTGATGAGGTAACCTTTACAAA
AATGTCATAGAGTTACCAATTGGGATTCAAGGCATCATCGCAATATACTTCGTTCTTTTA
CGGAGAAATTAAGCTCTTTCTACTTTGAATTAACTGTTAGACTTGTCTTATCTGAGGAAT
GTCCGTGTTCGAATTAAATAAAAAATTAGGGCAGTTTTATTTACCTTAACAAATATGTTC
AAGCATTTACGTTACTGCGCTCTCTTCTAGTTCAAGAACGGATAACTCATAGACTTACCA
GTACAAATTGTTGAAGGGTTCCCAATTGATAAAAAGGATCTCTTGCTTCCTAAAATAAAC
GTATAAAAAGCACCCTATTCATCAGTTATTATCCCTCGTCATGTTGTGGTTCTAATTAAA
ATATACTTTTGTAGGCCTCAAAAATCCATATACGCACACT
Chr coordinates Chr IX from 393675-389572
w3c xhtml validator w3c css validator