Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DAL1
Systematic Name YIR027C
Alias allantoinase
Strain S288c
Description Allantoinase, converts allantoin to allantoate in the first step of allantoin degradation; expression sensitive to nitrogen catabolite repression
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DAL1 YIR027C
TTGAGGAGTTGTCCACATACACATTAGTGTTGATATTCTTGTTCTTGTTGAACTTCCCAT
TTTCCACATCTATAATATCATCTTCATTGTTTGTATATGACACAATAGATGTGGAGGGTT
GGACACCTTTCCTCGAAGGATTACTGAAAATAGCACTTAGAGCGTCGTTAGCCATTCTCG
TCTTTGTTGATGTTTTATATCACAAGATGTAGATGAATATAAAAGGTCAAAAAGGGAAAC
TAAAGTAACATATATATTCAAACTACTCATCAAGCTAATTATTTATACTTTTTTTTTCTT
CCCCATGTTTTCCTAGCCTTCTATGCTCAACACTAGCAGATCAAGTTTCTCGATTACAAA
CTTGTTTCTCTGATACTCTACCTCTCTATGCTAATCATTGGACACAATTTTTAAAGGAAC
CTTATCGACGTGACAGCAAAGCGGTCAATCCATCCTATTATTCCTTCTCATCTCCCTGAA
AAGGAAAACATCCTGGATCTTCAATTACACATACACATTCCTTATCGCAACTAGATTAGA
GGCGCTATTTTGTATGCGACAGCGAGTAAGGATGGCCGGAAAAAAAGCGGGCGCATTTTC
CCTGGCAGAAATTTTTCATTGATAAGAAAGTAATACCGATAAGAGATACCCTCGAGCCAC
ATTAGACCCGAGAATTGCAGGAAAGAAAGGAACTGCATGTTTCGATTCTATTGTCCCTTA
CTGCGGATCATCGAATAGGCGCAAATGTGTTGATGGTGGACTGATGGAACTTTATCAGGA
GAAGTGGTTCAAAATTGCGGTGCTTAATTATCTATATAGAGGAGGCATATCTCATCGAAG
GGGACAATGATGAGGTAACGCAAAAGTGATGAGTTTCTACTGGTATCTTGTAATTGAAGG
TACCCCTTTTTCTTTTAGCTATCTTTAATTAGGTTAGAAAAGTGTATATTTCGCAAAAAC
GTATAGGCAAAAAAAAAGTGAAATACTGCGAAGAACAAAG
Chr coordinates Chr IX from 407642-406260
w3c xhtml validator w3c css validator