Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DAL4
Systematic Name YIR028W
Strain S288c
Description Allantoin permease; expression sensitive to nitrogen catabolite repression and induced by allophanate, an intermediate in allantoin degradation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DAL4 YIR028W
GAGATACGTTCTCCAGCGTATGTATTTCATATTTGGTTATCTCAGTTTTCTCCATAACCA
CGGAGCCTTCTAAAACATCCAGAATCGTGCCTGATTCGGTCGAATACACAATAGTCGCAG
GTTTATTTGCACCATTGATAATGACATGGTCGGAAGTGATGGCATTGATAGGCATCTTTG
TTCTTCGCAGTATTTCACTTTTTTTTTGCCTATACGTTTTTGCGAAATATACACTTTTCT
AACCTAATTAAAGATAGCTAAAAGAAAAAGGGGTACCTTCAATTACAAGATACCAGTAGA
AACTCATCACTTTTGCGTTACCTCATCATTGTCCCCTTCGATGAGATATGCCTCCTCTAT
ATAGATAATTAAGCACCGCAATTTTGAACCACTTCTCCTGATAAAGTTCCATCAGTCCAC
CATCAACACATTTGCGCCTATTCGATGATCCGCAGTAAGGGACAATAGAATCGAAACATG
CAGTTCCTTTCTTTCCTGCAATTCTCGGGTCTAATGTGGCTCGAGGGTATCTCTTATCGG
TATTACTTTCTTATCAATGAAAAATTTCTGCCAGGGAAAATGCGCCCGCTTTTTTTCCGG
CCATCCTTACTCGCTGTCGCATACAAAATAGCGCCTCTAATCTAGTTGCGATAAGGAATG
TGTATGTGTAATTGAAGATCCAGGATGTTTTCCTTTTCAGGGAGATGAGAAGGAATAATA
GGATGGATTGACCGCTTTGCTGTCACGTCGATAAGGTTCCTTTAAAAATTGTGTCCAATG
ATTAGCATAGAGAGGTAGAGTATCAGAGAAACAAGTTTGTAATCGAGAAACTTGATCTGC
TAGTGTTGAGCATAGAAGGCTAGGAAAACATGGGGAAGAAAAAAAAAGTATAAATAATTA
GCTTGATGAGTAGTTTGAATATATATGTTACTTTAGTTTCCCTTTTTGACCTTTTATATT
CATCTACATCTTGTGATATAAAACATCAACAAAGACGAGA
Chr coordinates Chr IX from 408468-410375
w3c xhtml validator w3c css validator