Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DAL2
Systematic Name YIR029W
Alias ALC1, allantoicase
Strain S288c
Description Allantoicase, converts allantoate to urea and ureidoglycolate in the second step of allantoin degradation; expression sensitive to nitrogen catabolite repression and induced by allophanate, an intermediate in allantoin degradation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DAL2 YIR029W
TCTGTGTGGCAATGGCTCTATGTATCTGTCCATGGAACTTAATGGCCAGTTCAAGTAAGT
TCACCAGCGCTTTGGGTGCTTATGCAATTTTCCTTTCCAGTATTGCTGGTGTCATTTGCG
CGGATTATTTCGTAGTAAGAAGAGGATATGTGAAATTAACACATTTATTCCTGGCACAGA
AGGGTTCCTTTTACATGTTTGGAAACAAATTTGGTGCCAATTGGAGGGCCTTTGTTGCGT
ATATTTGCGGTATCGCTCCAAATTTACCAGGTTTTATAGGTGATGTTGGAGCTCCAAAAA
TTACGGTTTCAGAGGGTGCAATGAGGTTATACTATTTAGGTTATCCGGTAGGTTTCTTTA
TTAGTGCGGTGATATACCTCATATTATGTTACTTTTTTCCTGTCCCTGGTACTCCCGTAA
CCAATTTTCTGACAGAGAAAGGATGGTTCCAAAGATGGGCTTATGTTGAGGACTTCGAGC
AAGATTGGAAGAATGAGTTACGTAGGGATGACCTCTGCGATGACACAGTCAGTATCTATG
ATGGCACCGAGGAAAAGATAGTTTACTAAATAAAAATCCCAATTTATTCTCTTACCAGTA
GTGATCAGGAGAATTGATAATTTCTTCAAAACACCTTAATATTCGTTCTGTGTATTTTTA
TGTACCTTTCTTAATCAAATTTATCAGCTTCATACATGCATTCCCGTCTGAATAATGTAC
TGATGATTAGCTAAACCGTCATCAACCTACCAAACTTGCGCTTGTTTGAGCCTATCAGAA
CTCCGGATAATTCCGACATCTTATCTTTGACTCGAATTAGCGATAAGATAAAAACACAGG
AACCACAATGAAATTCAGCTGGAAGAAAAGTCTAAATTATAGACACATTTTCTGAGATCA
AATGCTATAAAGGAATGGAAGTGCATTTTGCTATGATATGGGGAAATTATGAAGCCGATC
AAACAATTAATTGTATCTAATCGGTCTCTTCTTTAGAAAA
Chr coordinates Chr IX from 410807-411838
w3c xhtml validator w3c css validator