Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name LYS1
Systematic Name YIR034C
Strain S288c
Description Saccharopine dehydrogenase (NAD+, L-lysine-forming), catalyzes the conversion of saccharopine to L-lysine, which is the final step in the lysine biosynthesis pathway; also has mRNA binding activity
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>LYS1 YIR034C
GTGGATGTTCTTTTCAGTTTGGACAAGGACACGGTTGTTTACGGTGTAGCCAGGTCTGAG
GCACCCTTGAAGAAGTTGAAAGAGAAGTATGGCGACAGGTTTTTTTACGTTGTCGGTGAT
ATTACCGAGGATTCCGTGTTGAAGCAGTTGGTTAACGCTGCTGTTAAGGGCCACGGCAAG
ATCGACTCCTTGGTTGCCAACGCTGGTGTCCTAGAGCCCGTGCAAAATGTCAACGAGATT
GATGTCAACGCTTGGAAGAAGCTGTATGACATCAACTTCTTCAGCATTGTTTCCTTGGTT
GGCATTGCGTTACCTGAATTGAAGAAGACCAACGGTAACGTGGTATTCGTCAGTTCGGAC
GCCTGTAACATGTACTTCAGCAGTTGGGGAGCTTACGGTTCTTCAAAAGCCGCTCTGAAC
CACTTCGCCATGACTCTGGCCAACGAGGAAAGGCAAGTGAAAGCCATTGCCGTCGCCCCA
GGTATTGTGGACACAGATATGCAAGTTAACATTAGGGAGAACGTGGGGCCTTCCTCCATG
AGTGCAGAGCAATTGAAGATGTTTAGAGGTTTAAAGGAGAATAACCAGTTGCTGGATAGC
TCTGTGCCAGCTACAGTTTATGCCAAATTGGCCCTTCATGGTATTCCTGACGGTGTTAAT
GGACAGTACTTGAGCTATAATGACCCTGCCTTGGCGGACTTTATGCCTTGAGGATAGCAG
GTACATATAAATTGTTACATACTAAGTCGATGAGTCAAAAAAGACTCTTATACATTTATA
CATTTTGCATTATTATTTTTTTTTTCCAGCGGAATTTGGAATTCCGCTCTCAACCGCCAA
AATTCCCCTGCGATTTCAGCGACAAAGAGTCATAAAGTCATCCTCGAGAAACCACGATGA
AATATATAAAAAGCCCATCTTCCCTGACGGAAACTGGTATTTTAGGAGGCATACCATAAG
ATAACAACGAAAACGCTTTATTTTTCACACAACCGCAAAA
Chr coordinates Chr IX from 420736-419615
w3c xhtml validator w3c css validator