Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NRE1
Systematic Name YIR035C
Strain S288c
Description Putative cytoplasmic protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NRE1 YIR035C
GACGATGAATGCATCGTCTACGGCGTAGCAAGAACGGAAGCTGGTCTGCAGTCTTTGCAA
AGAGAATACGGTGCAGACAAATTTGTCTATCGTGTCCTCGACATCACGGACAGGTCTCGA
ATGGAAGCGTTGGTGGAGGAAATCCGGCAAAAGCATGGAAAACTGGACGGTATTGTCGCA
AATGCGGGGATGCTAGAACCGGTGAAGTCCATCTCCCAGTCCAACTCCGAACACGACATC
AAGCAGTGGGAACGGCTGTTCGATGTGAACTTTTTCAGCATTGTCTCTTTGGTGGCACTG
TGTTTACCCCTCTTGAAGAGCTCGCCATTTGTAGGCAACATTGTCTTCGTCAGCTCTGGA
GCCAGTGTGAAACCATATAACGGATGGTCGGCGTACGGCTGCTCGAAAGCCGCATTAAAC
CACTTTGCCATGGACATTGCCAGTGAAGAGCCCAGTGATAAAGTGCGTGCCGTGTGTATT
GCACCGGGCGTCGTTGACACGCAGATGCAGAAAGATATTAGGGAAACATTGGGTCCTCAG
GGCATGACACCCAAGGCTCTCGAGAGGTTTACTCAATTGTACAAGACTTCGTCACTGCTG
GACCCAAAGGTGCCTGCGGCGGTACTAGCGCAACTCGTCCTGAAAGGTATTCCCGACTCT
TTGAACGGTCAATATCTCCGCTACAACGATGAGCGACTGGGGCCGGTGCAGGGCTAGTAC
TAAACTATATTATGTAAAAGGGTATAGTTATAGTTTTTAGCTACTAAACTTTTATTGGGT
TTGCGATGAGCGACAGTTTTGTGCGGCCATTTCTGTGCCAAGAACCGGATTGAATGTATC
ACCGAAGGAATTCCGCGGTGTTTTCAAAGAAATGAAGAGAAGACAGTATGAACATTAACT
TTTGCATATATATACGTAAACGAAAAAGATCAAGTGCAATGGAAGAATATTGTACCTAAA
AAAAAGGGTCTAACTACAGCGTGTAACAGGTTAAAAAAAC
Chr coordinates Chr IX from 421790-421026
w3c xhtml validator w3c css validator