Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NRE1
Systematic Name YIR035C
Strain S288c
Description Putative cytoplasmic short-chain dehydrogenase/reductase
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NRE1 YIR035C
GACGATGAATGCATCGTCTACGGCGTAGCAAGAACGGAAGCTGGTCTGCAGTCTTTGCAA
AGAGAATACGGTGCAGACAAATTTGTCTATCGTGTCCTCGACATCACGGACAGGTCTCGA
ATGGAAGCGTTGGTGGAGGAAATCCGGCAAAAGCATGGAAAACTGGACGGTATTGTCGCA
AATGCGGGGATGCTAGAACCGGTGAAGTCCATCTCCCAGTCCAACTCCGAACACGACATC
AAGCAGTGGGAACGGCTGTTCGATGTGAACTTTTTCAGCATTGTCTCTTTGGTGGCACTG
TGTTTACCCCTCTTGAAGAGCTCGCCATTTGTAGGCAACATTGTCTTCGTCAGCTCTGGA
GCCAGTGTGAAACCATATAACGGATGGTCGGCGTACGGCTGCTCGAAAGCCGCATTAAAC
CACTTTGCCATGGACATTGCCAGTGAAGAGCCCAGTGATAAAGTGCGTGCCGTGTGTATT
GCACCGGGCGTCGTTGACACGCAGATGCAGAAAGATATTAGGGAAACATTGGGTCCTCAG
GGCATGACACCCAAGGCTCTCGAGAGGTTTACTCAATTGTACAAGACTTCGTCACTGCTG
GACCCAAAGGTGCCTGCGGCGGTACTAGCGCAACTCGTCCTGAAAGGTATTCCCGACTCT
TTGAACGGTCAATATCTCCGCTACAACGATGAGCGACTGGGGCCGGTGCAGGGCTAGTAC
TAAACTATATTATGTAAAAGGGTATAGTTATAGTTTTTAGCTACTAAACTTTTATTGGGT
TTGCGATGAGCGACAGTTTTGTGCGGCCATTTCTGTGCCAAGAACCGGATTGAATGTATC
ACCGAAGGAATTCCGCGGTGTTTTCAAAGAAATGAAGAGAAGACAGTATGAACATTAACT
TTTGCATATATATACGTAAACGAAAAAGATCAAGTGCAATGGAAGAATATTGTACCTAAA
AAAAAGGGTCTAACTACAGCGTGTAACAGGTTAAAAAAAC
Chr coordinates Chr IX from 421790-421026
w3c xhtml validator w3c css validator