Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name IRC24
Systematic Name YIR036C
Strain S288c
Description Putative benzil reductase;(GFP)-fusion protein localizes to the cytoplasm and is induced by the DNA-damaging agent MMS; sequence similarity with short-chain dehydrogenase/reductases; null mutant has increased spontaneous Rad52p foci
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IRC24 YIR036C
GAGGAGTCGTATGCTGCTTCTAAGGAAAAGGCGCGTGCTTTAGGTAGCAATTTCTAAACC
GTTTTGTTGCGTTCGTACGGCACTAGCAGCCGCGTAATTCGTTCACACACTTCAATACAT
ATGTATGTATACGTATATAGTCTGTTGCGACACATAATAATTGACAGGTTTGACTAGCGA
GTATGTATTATCAGGAAATATAAAAGAAAACTAAGCTTTACCTAACTTCAAAAGAAGAAG
ACCTGCCTATTCCACCTCTTTCAAAAGTTCTTCGATGGTTTCGGACAACGAAGAAGGTTT
GGTTAGTGAAGAGTATCTTTCGTACACTTTACCCTTTTTATCGACTAAGAATTTTTCAAA
ATTCCATTTGATACCTCTCAAGCCCAACATACCGGATTTTTGGCTCTTCAAAAACTTGTA
AACAGGGTCCTCATTGCCACCATTAACGTCAATTTTTTTCATAATGGGGAAAGTCACGCC
ATAGTTCAGTTGGCAGAACTGGGCAATTTCTTCATCAGAGCCAGGTTCTTGGTGGCCAAA
CTGGTTGCATGGGAACCCGATGATGGTAAATCCTTCGTCCTTATAACGTTTGTACAAGGC
CTCTAGTTCTTTGTATTGAGGAGTGAATCCACATTTGGAGGCAACATTAACGATAAGCAC
CACTTTTCCCTTTAATTGGTCGAAGGGGAATGGTTGGCCTTTCTTGTCAACAGGTGCTAG
CTTATAGAATTCTGACATGATAAACTTGAATACTTTACGAGATGACAGCTTGGAAGAGAG
AGACGTGGAAAGCTCTGATGCTGTTTTTATTACTATTGCTTTTCCGATATTAAGGGAGCA
TACTGTTCCTCATGGTTTTTTCCCTCTTTTTTTCACTTTTTGACCTTTTTCGTAAAGTGG
CTAAAAACGATAATGCAGAAAAAGAAGAAGGAATACAGGAAATAAGGGCTGTCGCGAACA
GCAACAAGAGAAACAACTTATAATCTGTCAAAGAAGGGAT
Chr coordinates Chr IX from 422865-422074
w3c xhtml validator w3c css validator