Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YIR044C
Systematic Name YIR044C
Strain S288c
Description Possible pseudogene in strain S288C; YIR044C and the adjacent ORF, YIR043C, together may encode a non-functional member of the conserved, often subtelomerically-encoded Cos protein family
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YIR044c_YIR044c	YIR044c upstream sequence, from -1000 to -1, size 1000
ACTAACCACTCAATTTTTATAAACTTATGTCAATATTACAGAAAAATTACCACTAAAATC
ACCTAAACATAAAAATATTTTACCTTTCAACTTTACGAAATAAACACTTTGACTTGAAGT
ATGAGCACTACCATGACGTCATTAATGTAAAAGTTCCTTAATATCGTCGTACCACTATGC
TCTATTTAATATATTGTAATATAACTGCACTCTATAGTCATACAGATATTTTCACTTCGC
CCTATCTTCCCATACTATTGTCATGGAATCTCACACTGACGCATGATTAAACGAACAATT
TATACTATAAGGTCTGTCATTTGCGCTCTATCCTTTTGTTTGCAATATTTATATACAGAA
TCTCAAAACAAGCGGGAGAAGTGGTAATTACCCAGAGGTCATGCATGATCTGAGTACCAC
CATACCTCTAAGTTTTTGCTTTGATCCGTTTTACAGTGACAACAAACATAAGGAGAAGGC
ATTAAAATGGTATCGAAAGGTTATCAATATAGGGAAATAAATTGGTTCTATGAATCTTCA
TGTAAGATACTCGTAGGCCAGACTCTTTCCCGTGTAAATATTTGTGACAGCTACGTCTAT
TTTCTACTATATGTTTACACAGTTTTCTCACAGGCAATCTACGCTTAAATATGTGTTTCA
TTTCAGGCGGCAACTGCTGTGCGAGCAGTGACATTGCCGGTCGCACCTTAAAACGTAAGC
CAAAGTTATGACACGCTCTCAAAGTACCCGCATTAAAGTTTTATAAAAGTATTATTACGA
CTATCGAGTAACTTAGATAGAAAACCGGAAATGAAATGGATGCCCTTTTCGAATAGCTGA
GTTTCTTTGTCTAAAATAGCCCAACATTGTTGCCCTTTTTCTATCATGAGATTGCACGAA
CGCGCGCGCTTCGGCGGCTTTTTTTTCTGCTACATAAAAGCGAAAAGGAAGAAGTTATTA
CTTTGAATAAAAAAACCTCGAACTGCCATCTCACTACCAA
Chr coordinates
w3c xhtml validator w3c css validator