Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CYR1
Systematic Name YJL005W
Alias CDC35, FIL1, HSR1, SRA4, TSM0185
Strain S288c
Description Adenylate cyclase, required for cAMP production and cAMP-dependent protein kinase signaling; the cAMP pathway controls a variety of cellular processes, including metabolism, cell cycle, stress response, stationary phase, and sporulation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CYR1 YJL005W
CGCTCTATAGATACAGATATATATATATATATATATATATCTATGTGTATAAAGACGGCT
TTCAGGACAGTACTTGTTTGGATTTTTGATCATCGCGGATTTTCGCAATGCAAGTATAAA
GAGAGCATTACCCGCCACACAGTGATTCTTCAGCAAGTTGTACCGAAAAGGACCATTTAG
GTACGTGGGATCGCAAAGGTTCCCAAACGGTGTGCATCAAGCCGTAGACTTCATGAGTGC
TTTCGGTGCAGCAAAAAGATAAGGACAAAAAATACTGAAGGATGCGAGGTTCGAACTCGC
GCGGACAACCGTCCAACAGATCTTAAGTCTGCCGCCTTAGACCACTCGGCCAACCCTCCA
TCTTATTTAAAAATCCTAGGAAATAGATGTTATATAAGTCATACATCATTGAAAACATCA
AATACCGTTCCCTGCGTTGTTCTACAGAAAAGCGCATTAGAGTAGGTCATACCCTTTAAA
AAATGATTTTGTAAATGCCAGAAAGTAAACAAATATGCATTTCGCCTAGCTCCCAATGTA
AATAGCCATAAAAAAGGATAAAATGCCAGATTTAGAGTCAGTTCTCGTTCTTCTTCTTCT
CTGTGTTCAATTGTTCAATTGCATTGTTAATCACTGAAATTCTATGTTTCAAATTGGAAT
GGCAGACTGAACTGAGACCTTCCTTACTTTCTCCTCTATCAAACCTAAATATTCAATCAT
AACCTTATTTTTTCACTTCCTTTTTCTTACTTTTTTTTTTTTTTTTTTTTTGTATTTTGG
AAGGAAAGCAGGGGGGACTTACCATAAGAAAAGCGACTCTAAAAAAGTGTATTTTCTTCC
AAAGTTCAGTAAAGACAGCTGGGAAGTATAGTAACAGAGGAGAGAAAGCATAAGGAGACC
TCTTGCTGCAGTTCACAACCAAAAATAGCATATCTTTACTATTGTCGCTAACCATTGCGA
AACGAGCTAAAGCAACAGCAAACGAAATCCCTAGGTCGAA
Chr coordinates Chr X from 425157-431237
w3c xhtml validator w3c css validator