Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name VTC4
Systematic Name YJL012C
Alias PHM3, YJL012C-A
Strain S288c
Description Vacuolar membrane polyphosphate polymerase; subunit of the vacuolar transporter chaperone (VTC) complex involved in synthesis and transfer of polyP to the vacuole; regulates membrane trafficking; role in non-autophagic vacuolar fusion
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>VTC4 YJL012C
CAATCAACTTCCTGCCAATATGGTCCACCTTTACTCCATAGTGGAGGAGTGTGATGCAAG
ATTTGACGAAAAAACAATTGAGGAAATGCTAGAGATCATCTCTGGCTACGCATGAGTGTA
CAGTGCTTTGAATTGATTTGGACTGGCACTTCCGAAAAACAGAAATTACTTTGTTGTGTA
ACAATATAACATGTTCAATGAGTATGCATGTATTATTGAACTTAAGCATATAGAAATATT
TACAAGAATATACTTTATTTTTTAGAGTTTATTGCGCACACTTTGGGTTAGTCTCGATTT
TTTTTATTTCCATTGGAGGAAGGTTATTATTTGGAAATTTAGTGCTGCGTTATAAACGTC
TGTAAAGCCAGTACCACAAGCAACTTCGGTGAGATTTAACTTTTGTTTATTCTGTATTTT
TGTCGAGGCTTAAAAGGGTATACTAGTTGAGGGCGTTACAGTAATCCCTTCATGGCAAGA
ATAAAGTAATAGTTATATAATAATTGTCATACGCATTGTTATACCAGTTGACGAGTAAAA
AAAGACGCACCGTGACTTCAAGAGCTGTCGCAAACAAGTTCGACAATATTTAACTTATAA
ACATATTAAAGCTTTCAAAAATATAGTCTTTCGAAGAGCTTTTTCATACTAAGAGAAGCG
TTGCTAATATTCCGAATTAATCACGCAATTGCCTCTCTGCTTTCCACGTAACCCATCATA
GGAAATTGTATTAATATGTTACTTACTGGAATTGCACAGGAAAACACCGACAAAAAATTG
GTTTGTCTGCGTTTTGACGGAGAGCTACTGACTTGTAGGTTCACTTTTTCACACACCGCA
CTATGCATATATGTTGCATTTTTATTATTCATCCGCACGTGGCTGCACACGTGAATGAAA
AAGAAGCAATACTATCTTTATATATTGAGGCAATCAGAAAGAAGTTACAGGCTAACAATC
AAATCGGCCAATAAAAGAGCATAACAAGGCAGGAACAGCT
Chr coordinates Chr X from 413399-411234
w3c xhtml validator w3c css validator