Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name Uncharacterized
Systematic Name YJL017W
Strain S288c
Description Hypothetical ORF
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YJL017W	6322443 upstream sequence, from -1000 to -1, size 1000
GTTGACAGATTCTAGAATACGCCAACAAATGTATCTGCCCCCATGGTTCATTCAGTTAAA
ACCACTCGTACGCTCAATTGTCTTTCAAGTGGACGAGAACTACGGGAACAAAAAGTTCAT
ATCTCTGAGGAAATTTATCATCAACGGAGTGACACCGCAGGATTTGCAAATAATTGAAAA
TAACGAGTTCCCTGTTTTACTGGGTGACACCCCAGAATATGGTGTCACTCAGAACACCGA
CGAAGGCAAGAGGAAAGTTCTCCTATCAAAGCCTCCTTACGCGTCTTCATCTACTAGTAC
CAAGTTTCATCCCGCTTCTAACGTCCCATCATTTGGCCAAGATGAGCTAGATCAATAAAC
GACAATAAAAAATTAAACGTTCTAACCCCCTGGCCCCCAGAAAATCGCGCAGATTGACGG
CACTCCCTTTAAATCATAGAGTTAATCAGCTACTCACCACTCTCTTTCGGTACTGGCGTT
ATTCTGAATTCCAACCTTGAACACAGCCACACGGCATTCAGATGTTGCTCCCATGCGTGG
ACTCACGCTCTGCGATTAACAGCTCATGGAAATTTCCTCGTGCTATTTAAGACTGCAGTC
GTTTGGAAATCGGAATATCTTTTTTCGTGCAGTTTTGCGGGAAATTTTCCCTACTTAAAA
AGCTGAATGAAAATCAGAAATATCTGCAAAAAAAAAAGGTAAAAAAGGGAAATTTTAAGA
CATAGCATAAAGGACTTGGTTTTGTTTCAATACTCAGCCCTTTTCATTCATTTCTATCAC
AAGTTTTTTTTTGCTCTCGTTTCCATTTTCTTCGTTTACTTATTATTGACGTACATCTTT
TTTAGTTTCAAATAACATAGCAAGAAGGCTTAACTAAGTTCCTATATTCTTGGCATATTT
ATCATCATCAGGTCTTTTAAAAGTATCTCAGAACGTAACTTCAACGCCTTTAGATTTTTT
TCACAACACGACTCTATTGCAAGAGACAAAAAAAATTAAA
Chr coordinates
w3c xhtml validator w3c css validator