Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SNX4
Systematic Name YJL036W
Alias ATG24, CVT13
Strain S288c
Description Sorting nexin, involved in retrieval of late-Golgi SNAREs from post-Golgi endosomes to the trans-Golgi network and in cytoplasm to vacuole transport; contains a PX phosphoinositide-binding domain; forms complexes with Snx41p and with Atg20p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SNX4 YJL036W
TTTGTACCACATAAGGTAATATACACGTAATAATAGGCAATAGATGTGTGCGAATGAACT
TCCAATATAATCCATTTAGTAGTGCCTTTTGTTACTAATATTCGTCAGTTTCTCAAGCTG
ACACTTGATTTATTCTAAACAAATTTCAATCTTGGACAATTAGTTGACATAAACTACGTT
ACTAATTTTTGTTGTATTAAGGGCTTAAATAATACCGGATGTCTTGGCAATTCTATCGTT
AGGAGAGTAATAGTTGTCAGACTTATTGTCGGCTTGTTCGCACATCGTTACTTATCCTAT
ATTATACATAAGATCTGGTGAAGCGAGGAGTCCCATGTCTAAACCGATTGCTCAGGTATT
TACAGGTTTAACTGCTTCATTTAAGCAAGCAATTATTGAATTATATACTCAATCTTGTCT
CTCCCGTTACTATTATTTCATTCGCGTTTTATACATCTTTATTATTATAAGTTTGATACG
GTAACTTTACAATCGATTAATTTCTGCTGAAAGCCCAAGCTTTCATAAATTAATAGGTTT
CGTGGTCTAGTCGGTTATGGCATCTGCTTAACACGCAGAACGTCCCCAGTTCGATCCTGG
GCGAAATCAATTTTTTGTTTTTTTAATTCACAAGAATAACCTGGTATTGTTATAAGCAAG
CCACCCTTTGCGTACGATCAAACACCCTATAAAATCTATATGCAATACTGAGATATTGTA
TTTTTTCTCCTTTAATTGTTTATAGTTCAGAATAACAGTTCAAAAATCTATGCCGCGCTC
ACAGGGTCCTGCCGGGTATTCGCCCTCCAGCTTGAAAGGGGTGGCAATGCCCAAGAGCGA
TGTATAGTTTAGTATCAAGGAATTGAGAGAGGTATTACACCAAGGATTTCCGTGAACGAA
GTGACGACGCAAGATTAACAGATTAAATTCTGGTAGTAGGCTAAGCCGTTATTAAACTTT
ATTTACGGTATACCACAATACTGCTCTTTTTGTTGAGGAT
Chr coordinates Chr X from 378825-380096
w3c xhtml validator w3c css validator