Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name IRC18
Systematic Name YJL037W
Alias OSW6
Strain S288c
Description Putative protein of unknown function; expression induced in respiratory-deficient cells and in carbon-limited chemostat cultures; similar to adjacent ORF, YJL038C; null mutant displays increased levels of spontaneous Rad52p foci
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>IRC18 YJL037W
ATGAAAGTACAAATGATAGAAAGGATTTTTCTGATCCAGTTGTGTTTGCTTACCGTTGTA
TTAGCAAGTAGTAGAGCAGTGGTTGAATTCGAAAGTACCGGAACCAAACTGGTCAACTCA
TTAAGGGTCTTGGCTGCTTACTCGCAGAGTTCTGTCTGTGTTGATGAAAAAATATCTGGA
ATCGAGAGACAAATAGAGGAAGTTAAAGATATGTATGGTAACCACTCTTTTATTCTAAAG
GGTTTAAATGGTATATTGAATAACAAGGTGAATATGCTAACAAGGGAAATCCAAATGGAA
ACTGTTGGCAATAACACATTTGAAACAGAAACAGGGAAGCTAACTAAGGGCCTAAACCGA
GCAGTAAATATATCTCCGTTCAAGTACATAAAAAAATTCAAGACCGTTTCAACAAAGAAA
TTTGAAAGCCTCTTGAATAAGTATGATCTGGTTGCCAAGAAGGGCGGGGAATTGACAGAG
GAACAAAAGAAAAAGAAGGAGGTGCTCTCACGGATCAGTAGAGTAGTCGCTGCAACAACG
ATAGAGGCTGGTCTGGCACAAGGTGTGGTTGATTTATGTATAACAGTGACAACTAGTCTA
TGCTTAGTCTCGGCCAGCATTGGAGGCGTCGGATTTCTTATTTGGCTCACCATTATATAC
CAAGCTCTGACTTAG
Promoter Sequence
Download FASTA
>IRC18 YJL037W
TTTCTCAATGATGTGATTAACCTATCGCCCGCATCGCTGAACTGTTGTATTGTGTTAGTT
CCTGCAATCACAACAATGGTGAAATAAAAATATATGAAAAGCTGGAACCTCATTTGAATT
AGTTTACTTCACTAGGCTCTTTTATCTTCACTTATTGTTTTGTGGTGTCTATTTTTTTTA
CTGACAGTTTACACTTTTATAGTCTTTAAAAAAGCAAAAAAAATAATTCTTTTATTTTTA
TCCCAAGATAATAAATATTTATGTATTGGATAGTAGTATAATTGAGTATAAAAATTATTT
TTGTAGTACTTTTTCAAACTAATCTCTGCAAGACATATCTTCCATATTTTCACAATTATT
TAAGCCGATTGCAACAACATTCACCATAGGTGCCTTTTCTGCGGCAATGCGTAGCCCTAT
AATTAGCTGCTTGAATGAGAAAACCACAAAAAGGGGGATTGAATACATAGCATAGCTTAC
ACTGTATCTTAGTAATTTTTTTCCCTTCTACTTTGTTTTTCGCAGGGCCTTTGCCTTTGG
AAAAGGGTACACGAGTCTTAAGAGAAATGAAAAAAAATGACACTAAATCGGTGATAATAA
TTTGTCGTTGTGACCACAAAAAAGAATTCATAAAAAAAAAAACTTGATCATTGGCGCCAC
AACCTAGTCATATTTGAAATCATTTTTTTCCTTTATTTTTTACCACAGGGTGCGTTTAGA
AGAGACACAAAATCACTCTAGGGTTTTCTATCGAACATAAAGTAAATCATTTTTATATTC
CAAAATTGCTCGAAGTAAATCTCTTGTTTTCCTCCCAAATGAAGATCAATATTAAACCTT
TCTGAAAATCTTTTTTAATACAGATTACATTATAGAGTTGTATACTCTTCGATCATTTAA
CTTCTCTTTTATGGGTCATATATCTCTAATTGTCTCTACAGTACTTTTTTTGCTTTTCCA
ATAAAAATCATAATCACAGCCATAGTCACAAAACTATAAG
Chr coordinates Chr X from 376662-377336
w3c xhtml validator w3c css validator