Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name LOH1
Systematic Name YJL038C
Alias OSW4
Strain S288c
Description Protein of unknown function with proposed roles in maintenance of genome integrity and also in spore wall assembly; induced during sporulation; repressed during vegetative growth by Sum1p and Hst1p; sequence similar to IRC1
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>LOH1 YJL038C
ACCAGTTTGGTTCCGGTACTTTCGAATTCAACCACTGCTCTACTACTTGCTAATACAACG
GTAAGCAAACACAACTGGATCAGAAAAATCCTTTCTATCATTTGTACTTTCATCTTATAG
TTTTGTGACTATGGCTGTGATTATGATTTTTATTGGAAAAGCAAAAAAAGTACTGTAGAG
ACAATTAGAGATATATGACCCATAAAAGAGAAGTTAAATGATCGAAGAGTATACAACTCT
ATAATGTAATCTGTATTAAAAAAGATTTTCAGAAAGGTTTAATATTGATCTTCATTTGGG
AGGAAAACAAGAGATTTACTTCGAGCAATTTTGGAATATAAAAATGATTTACTTTATGTT
CGATAGAAAACCCTAGAGTGATTTTGTGTCTCTTCTAAACGCACCCTGTGGTAAAAAATA
AAGGAAAAAAATGATTTCAAATATGACTAGGTTGTGGCGCCAATGATCAAGTTTTTTTTT
TTATGAATTCTTTTTTGTGGTCACAACGACAAATTATTATCACCGATTTAGTGTCATTTT
TTTTCATTTCTCTTAAGACTCGTGTACCCTTTTCCAAAGGCAAAGGCCCTGCGAAAAACA
AAGTAGAAGGGAAAAAAATTACTAAGATACAGTGTAAGCTATGCTATGTATTCAATCCCC
CTTTTTGTGGTTTTCTCATTCAAGCAGCTAATTATAGGGCTACGCATTGCCGCAGAAAAG
GCACCTATGGTGAATGTTGTTGCAATCGGCTTAAATAATTGTGAAAATATGGAAGATATG
TCTTGCAGAGATTAGTTTGAAAAAGTACTACAAAAATAATTTTTATACTCAATTATACTA
CTATCCAATACATAAATATTTATTATCTTGGGATAAAAATAAAAGAATTATTTTTTTTGC
TTTTTTAAAGACTATAAAAGTGTAAACTGTCAGTAAAAAAAATAGACACCACAAAACAAT
AAGTGAAGATAAAAGAGCCTAGTGAAGTAAACTAATTCAA
Chr coordinates Chr X from 375774-375115
w3c xhtml validator w3c css validator