Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RTT101
Systematic Name YJL047C
Alias CUL8, CULC
Strain S288c
Description Cullin subunit of a Roc1p-dependent E3 ubiquitin ligase complex with a role in anaphase progression; implicated in Mms22-dependent DNA repair; involved with Mms1p in nonfunctional rRNA decay; modified by the ubiquitin-like protein, Rub1p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RTT101 YJL047C
TCCTCTCTCATTCAAATCTAGTCTTAGTTCGGGATTCAATGAATTTAACCACTTAATTAT
CATTTTGTTGAAAAACTTTGTTTCGAATTTCTCCCTTGATGTTAAATATGAATAATTAAC
ATTGCCCAAATCATGCAGTACAGTGCCACCTCCAGAAAATCTTCTAAGTAGTTCGAAATT
CTTACTCTTCAGCTTAGCAAGATCTACTTCCTGCCACAGATTTTGGTTTTTGCCTATAAC
GGCGCACCTATCATTGATGTAAAATAACAGTCTGCAATTATCGGGACCTCTTTTGGCTCT
TGGTGTATTCTTGAAAACATAGTTTTCAAGGGCCAAATTATAATAAGGACTGGTGGATAA
ACTTTGTATAACAAATCTGCCCTTTGCCTTTACTATATTTTCCAATTGTGAAGCAGACAT
GATCTGTTTGGCATATCCAATATTATAGAAATTGTACAAGTCTTTATTAAAAGCACTGAT
ATCTTCTTCCATAGAGCTGGCCTTCGTCGTATCATAATCAGATTTACCTTCATCCTGCAA
AATTGAAACGTTATCATTTGAAGGTGTAAACATGTTTTCATACATTGAGTTTATATCATG
ATATTTATCGTCTGCGTCTTTTGCCCATCGTGTAAGTGTGTGAAATAAAGTGGTGCAATG
TATGAGGTTTCGCTGTCCCACATATCGAGGGGAGAGTGCCCAATTACTTAGCATCATAGA
CATAATGTAAACATCAAAGAAAAGTCTAGTGTTTTCTTCTTTTGTATTCATCAAAAATTC
TACATACGTGAGCTCGGAGATTTTTGGATGTTCAATATTCCTGATTAAGTATGACGAAGC
GGAACGCATAGCTATCCTTTGCGTAATGATGAATATGAACAATGCGAATGAAGATCATCG
ATATCTTTGCACTAAAAGACTACTTTGAAGGAATCCTCAAGATATTAAACCCACCAATCT
TTTTTACTGGTATAAATTCTCGTACGGGTTCACAGGAACA
Chr coordinates Chr X from 352108-349580
w3c xhtml validator w3c css validator