Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TIM54
Systematic Name YJL054W
Strain S288c
Description Component of the mitochondrial TIM22 complex involved in insertion of polytopic proteins into the inner membrane
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TIM54 YJL054W
TTTGGGCGTTTAAGGAAGGAGAATTATTTCCAACAGTTGAATAGGAAGATCCCTAGAGTA
AATCGCAGGCAATCCAGTACTAAGAAACGGCGATGACAATGGAAAAAAATGGAGGTAATA
GCAGCCGTGGTGGCCAAGTAGGCGGCAAGTCTGTGTGTGTTTACTGCGGGTCTTCATTTG
GCGCTAAGGCGCTATACTCAGAAAGTGCAGAAGAATTAGGAGCCCTTTTCCATAAGCTGG
GATGGAAATTGGTATACGGTGGAGGCACTACTGGTTTGATGGGCAAGATAGCAAGGTCTA
CGATGGGACCTGATTTAAGCGGACAGGTTCACGGTATCATTCCAAATGCACTTGTGTCTA
AGGAAAGGACAGACGAGGATAAAGAAGATGTTAATAAAGCATTGTTGGAGTCTGTAGAAA
ATCATAAGGGCGCCACTCCTATTTCTGAAGAGTATGGGGAAACAACGATTGTACCAGATA
TGCATACGAGAAAAAGAATGATGGCAAATTTGAGTGACGCGTTTGTTGCTATGCCTGGTG
GATACGGGACTTTTGAAGAAATCATGGAATGTATCACGTGGTCGCAACTGGGGATTCATA
ATAAACCAATTATCTTGTTCAATATCGATGGGTTCTATGACAAATTATTGGAGTTCCTCA
AACACTCTATTCAAGAACGGTTCATCAGTGTGAAGAATGGTGAAATCATTCAAGTTGCCT
CCACTCCGCAGGAAGTTGTTGATAAAATAGAGAAGTACGTCGTTCCAGAGGGCCGTTTCA
ATTTGAATTGGAGCGACGAAGGTCACGCTCACGAGGATTGTGCTAAATAATAGAAACGTA
AGTCATGTATCTAGTTTAAACGATCTGTATAGATAATGTGGTGAAAAATCCAAATTTTTA
GGAGCTGTCTTTCTAAGCCCGAAGGCTGGAAAAAATAGTACTGATGGCAAAGACATCATA
GCTTTAAAGTCCATTGTTCTCAAAAGAAGCTCAATAGACC
Chr coordinates Chr X from 334265-335701
w3c xhtml validator w3c css validator