Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ZAP1
Systematic Name YJL056C
Alias ZRG10
Strain S288c
Description Zinc-regulated transcription factor; binds to zinc-responsive promoters to induce transcription of certain genes in presence of zinc, represses other genes in low zinc; regulates its own transcription; contains seven zinc-finger domains
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ZAP1 YJL056C
AGCGTGACCTTCGTCGCTCCAATTCAAATTGAAACGGCCCTCTGGAACGACGTACTTCTC
TATTTTATCAACAACTTCCTGCGGAGTGGAGGCAACTTGAATGATTTCACCATTCTTCAC
ACTGATGAACCGTTCTTGAATAGAGTGTTTGAGGAACTCCAATAATTTGTCATAGAACCC
ATCGATATTGAACAAGATAATTGGTTTATTATGAATCCCCAGTTGCGACCACGTGATACA
TTCCATGATTTCTTCAAAAGTCCCGTATCCACCAGGCATAGCAACAAACGCGTCACTCAA
ATTTGCCATCATTCTTTTTCTCGTATGCATATCTGGTACAATCGTTGTTTCCCCATACTC
TTCAGAAATAGGAGTGGCGCCCTTATGATTTTCTACAGACTCCAACAATGCTTTATTAAC
ATCTTCTTTATCCTCGTCTGTCCTTTCCTTAGACACAAGTGCATTTGGAATGATACCGTG
AACCTGTCCGCTTAAATCAGGTCCCATCGTAGACCTTGCTATCTTGCCCATCAAACCAGT
AGTGCCTCCACCGTATACCAATTTCCATCCCAGCTTATGGAAAAGGGCTCCTAATTCTTC
TGCACTTTCTGAGTATAGCGCCTTAGCGCCAAATGAAGACCCGCAGTAAACACACACAGA
CTTGCCGCCTACTTGGCCACCACGGCTGCTATTACCTCCATTTTTTTCCATTGTCATCGC
CGTTTCTTAGTACTGGATTGCCTGCGATTTACTCTAGGGATCTTCCTATTCAACTGTTGG
AAATAATTCTCCTTCCTTAAACGCCCAAAACATGATTATATATCACTGCAGACGGAGTAG
TTGACAGCAGTCATCTACCCTAAAGGTCATGATGAAACGTGCTTGGCAATATAAGATGCA
ACTGCAGTCACTGTGAATATAGGCCAGCGGCGAGACGGAAGCATTACACTTTTACTTTTT
ATGTGTTACGGTTTTTTAAATAGAAGAAGGATAGGAACTA
Chr coordinates Chr X from 333073-330431
w3c xhtml validator w3c css validator