Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name BNA3
Systematic Name YJL060W
Strain S288c
Description Kynurenine aminotransferase, catalyzes formation of kynurenic acid from kynurenine; potential Cdc28p substrate
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BNA3 YJL060W
ATAAAAGTCTTTTTTATGACCTTATTTGGTGAGTAATGCTACTTTTGTAAAGAGTGATGG
AAACTATTATTCCAAAGGGTTAGAAGAAGGTGAGGAATACGTTCATATCACCGCTACAGA
TCGTGTCTCTCGGTTATGAGTAATCAAACCCTCTGCAAGCAACACAGTTACTTTTTTTCG
GTTTTTTCTTTTCGTGTGAATTTTTATCCAGTGAGTTTCCTTGTTCACTTTCGAGAATGG
AAGGCTGATTTCGAATTTTTATATTCAACAACTGTATTTGTATTAGGCTTTGCAATAGTA
GATGAAAAGTGCAGAAGACGAATCTGCTACCCTCACAATACAAAGAAAAACAAAATCGTC
ATTTTAATATAGGAAGACACCGCTCAGGTAATTCAATATTGAATCTGGTTGCACTTTTCT
TACGATGTAAATACCCACAAACTTCTTGTACGGTGAGCGTCTGACAACGAAATCAATTTA
CGGAGCAAGGATTTTGACAGTAGAGCAGATTGTTTTGAGTAGGATTTAGGAATCAAGACC
TCCATCTTTGTCGCATTATTCCTAAATGTAACGTAACTCGTTTGATAAGAGAATGTCTAA
TCGAAGAGAGTTAATAACTTAATAAGCTCTTTAAAAGAACGATGGCATTTATCGTCTCCT
ATGCCAAGATAATTACTGGCTCAAAATTGTTCAGCGTTCATAAAACTTTGATATCACTTT
CTGGCGCACAAGCTAACCTTTATGTAGTTCTTACGTAGATTCTTTTTAGCAAGTGCCTGG
TAGTGGTTATTACATAAATGTATCTTTTCATTTGATAACAATTTCTTCAGTAGCATGTCG
TGTCTAGCACGTGACGTAGAACTGTGGCTTTTTTGTTGTCATTATGACAATCAAGATACC
AAAATTCAGTCATGTTTAAAAGGGGAAGGTACGATAGAGATATATATAAAGTGTTCAATT
TACTATAATTGCGTATAGAATCCATTGTTACTTGCTCTCA
Chr coordinates Chr X from 323386-324720
w3c xhtml validator w3c css validator