Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NET1
Systematic Name YJL076W
Alias CFI1, ESC5, SRM8
Strain S288c
Description Core subunit of the RENT complex, which is a complex involved in nucleolar silencing and telophase exit; stimulates transcription by RNA polymerase I and regulates nucleolar structure
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NET1 YJL076W
ATATACGAAAGACGAACACAAGAGAGCAAGCACACACAGCTAGTGCGTAGCGTTGCTAGC
TATATTGCCATGGTACCTACCTTTCACCTCCTTGTTAAATCCATAAGTGGACGGTTTTCC
TAAACCAGTATTTATCAGTTCTCGAGCACGCAGAGAAAAGTAAACGAAGCGACCTGCATT
GCGGTAACTATAAACACCCAGCCGCCTCCAGCAGAACCAGCCATGTGCGAAGAAAAACAA
TTTTTCGGCCAAACTTACCAACAATAGCGACGCGTTCCTCACATCGTTGGGTTTTTTTCG
CCTCTCTTCAAGTTTCCTATACCCGAGCTTAACACAACACAACGGACCCTCTTAATTAGA
GGTATCCTCCGTTCTTTTCTTCCGCTTTCCTAATCGAGATACCAGAGCACGGAACAGGAC
CCTAGTGCATCGGAGAGGAGATCCGTGGCACGCTCACTGCGCCTTTCACTATCACCGATT
TCGTAATTCGAACAGGAGTATTTCGCTGCAGGGGAATTACTGTTTGTAGACGAGGGAAAG
CAATTATCAGATACATGCCAGGGATAGCGTTCAAGGGGAAAGACATGGTTAAGGCAATAC
AGTTTTTAGAAATAGTCGTTCCTTGCCACTGTACGACCTGAACTTTACTCAACGAAAAAA
AAATTGGAAAAAAAATAGTGCATAACGTTGCTATTAACAGATGTAGTACTGATATGTCCC
TGATTGGTGAAGAGTCAGAATGATATAAGCCTATTTGATATGTACGTGTACGTATTCGAA
AATAAGATTTGTTTCTCGTAGGGAGCGATATGTGCATTATGTTACCCGTTCCACATGTTT
TGAACTTTTTTTCTTTTTCATGGTAAGCGTCAATAATCAATTTGAATAACTAGTGAAGAG
TAGCTAGCACGATGAAATAAGTGCCGGAGCTGATCGAATCCCTAGTCTCGGTTCGCCTGA
AACAGAGAGAAGTCGATTACTGTACACCGTGCCTCCTTCT
Chr coordinates Chr X from 295245-298814
w3c xhtml validator w3c css validator