Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NET1
Systematic Name YJL076W
Alias CFI1, ESC5, SRM8
Strain S288c
Description Core subunit of the RENT complex; involved in nucleolar silencing and telophase exit; stimulates transcription by RNA polymerase I and regulates nucleolar structure; NET1 has a paralog, TOF2, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NET1 YJL076W
ATATACGAAAGACGAACACAAGAGAGCAAGCACACACAGCTAGTGCGTAGCGTTGCTAGC
TATATTGCCATGGTACCTACCTTTCACCTCCTTGTTAAATCCATAAGTGGACGGTTTTCC
TAAACCAGTATTTATCAGTTCTCGAGCACGCAGAGAAAAGTAAACGAAGCGACCTGCATT
GCGGTAACTATAAACACCCAGCCGCCTCCAGCAGAACCAGCCATGTGCGAAGAAAAACAA
TTTTTCGGCCAAACTTACCAACAATAGCGACGCGTTCCTCACATCGTTGGGTTTTTTTCG
CCTCTCTTCAAGTTTCCTATACCCGAGCTTAACACAACACAACGGACCCTCTTAATTAGA
GGTATCCTCCGTTCTTTTCTTCCGCTTTCCTAATCGAGATACCAGAGCACGGAACAGGAC
CCTAGTGCATCGGAGAGGAGATCCGTGGCACGCTCACTGCGCCTTTCACTATCACCGATT
TCGTAATTCGAACAGGAGTATTTCGCTGCAGGGGAATTACTGTTTGTAGACGAGGGAAAG
CAATTATCAGATACATGCCAGGGATAGCGTTCAAGGGGAAAGACATGGTTAAGGCAATAC
AGTTTTTAGAAATAGTCGTTCCTTGCCACTGTACGACCTGAACTTTACTCAACGAAAAAA
AAATTGGAAAAAAAATAGTGCATAACGTTGCTATTAACAGATGTAGTACTGATATGTCCC
TGATTGGTGAAGAGTCAGAATGATATAAGCCTATTTGATATGTACGTGTACGTATTCGAA
AATAAGATTTGTTTCTCGTAGGGAGCGATATGTGCATTATGTTACCCGTTCCACATGTTT
TGAACTTTTTTTCTTTTTCATGGTAAGCGTCAATAATCAATTTGAATAACTAGTGAAGAG
TAGCTAGCACGATGAAATAAGTGCCGGAGCTGATCGAATCCCTAGTCTCGGTTCGCCTGA
AACAGAGAGAAGTCGATTACTGTACACCGTGCCTCCTTCT
Chr coordinates Chr X from 295245-298814
w3c xhtml validator w3c css validator