Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ARG3
Systematic Name YJL088W
Alias argF
Strain S288c
Description Ornithine carbamoyltransferase; also known as carbamoylphosphate:L-ornithine carbamoyltransferase; catalyzes the biosynthesis of the arginine precursor citrulline
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ARG3 YJL088W
CTTTTTTACAAATCCTCAAAATCAATTTCAAATTACTTCCTTTTGAGACAATCCATTACT
CACAAGAAGAGCAACGATTGTTAATAAGTTTGAATAAATTGAGATATTTGGATGCCGTAT
CGAGCTTTAATTCAAGTTCAGTCAAGTCGAATTTCGCGTCTAAGGTCAATACCCAGCTAA
ACCTTTTGCAACACTCGAGTTCTAACTCCAATTTCCTAGATGCGTCACCATACGATTTTA
ATAAAATTTTTATGAACAACTTTGAAAACTATGACTACGAAACAGATGAAGGATATGCGG
AAGATGATGATGAAGAGGATAGTGACAGTGACAATAGCTTACCACTAGAAATTCCTTTTA
AAAAAAGTAAAAATAAATGCAAGAATAGGAATAAAGAGCTTTCACAAAGGTTATCCCTAT
TTGAAAACAGAGATAGCAATTCGGTAGATTTCAACACAGATACAAATTTAAATTTAAACC
CTGATTCGCCATCAGTTACGTCTTCTAAGAAAAAATATTTAGATCATATTATTTTAGATA
ACCGAGACATCGTTAGCAACCATGACTCCAGTAAACAAAAATTCAAGATCCAGAATATTT
TGAACTCGACCTTCTAACATTACGCTCCTTCGTATTACTCATTCAGCTCTTCCTCTGATA
GCAGTGAATTTTCGAGGGTCACGTCGTGACTCATATGCTTTCTTGTTCCGTTTCGTTTCG
AGATGACAAAAAACTGGTCATTTTTTCCGTTAAGTGCAACTCACAGCAGTATCGGCCGCT
GAGAAATGCCCGGACAAATTTTTTTGAGCCGGATTGGTCACCGTTTCTTTCTTCGGCGCG
GCTTCCCATTCCCGTCCATCCAAAAAAATCTACCTATATAAATCGACTTTTCACCTCTAA
AGGCAGTTTATTCCTTGTATGTCCTTTAAGTACAGTTAATAACGAGCAATTTTTTTTTTT
TTTTTTAGCCATCTACCCATCAACTTGTACACTCGTTACC
Chr coordinates Chr X from 268799-269815
w3c xhtml validator w3c css validator