Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SIP4
Systematic Name YJL089W
Strain S288c
Description C6 zinc cluster transcriptional activator that binds to the carbon source-responsive element (CSRE) of gluconeogenic genes; involved in the positive regulation of gluconeogenesis; regulated by Snf1p protein kinase; localized to the nucleus
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SIP4 YJL089W
AACTTGTCTGGTCAAATCTTTAGAAAATATACCTCCTAACTTAATAATTTTCTTTGATAT
TTTTTTAGCTAAGATTTCATTATTTATTGCAGTCGGACAAAATGTTATTCCTTGAAAGGG
CTTCATAGTAATATTAATGCTACTGATAAAATACCTGCCATACTAGAAATAGAAGACTTA
TATATCACGTAAAATTTGTCTCTTCTTATTCATCATGTACATAAAACAGTACAAACATTA
CCAATAGTACTATATAGCTTTACCAGGCAATACGCGAATAGTCCATGCAGTTTTTCTTCT
CTTATACTGATGAGGGTAAGTTTTGCATTTGATCACCGCCGTATGCGAAGCGGAAAGAGC
AAATGCGTTGAAAGAAACCTGGCGACAATAGGAACCACGAGTTCAAGCTAATAATGATAC
CTCAATGATTATGCCCAGATTACGTTATGTGACTAAAGTAGAAAGGTGAATAAATATAAG
TAACGAAACAAGGTTACATGGACTCTTCAATTAAAGAAGGAAAAGGAAGGATTCTTTTGC
AGGCAGAAAACATTGAAGTTATATCGCAACAATAACGATGTAGTTATTATGACCTCATAA
TATGAGAACTTTTTCCTCAAGTATTTTTAAGTTATTCTGTGTGTCATGACTCTCACTTCG
TCATATTTTATGTTAGTGCACAAAATGCGAGGTGTGGGTGCAATCAAGACTCCGATCCAT
TTTCGCCGTTCGACCGGTGTTTTGGCGGCTAAATTTAAGGGCGTGATCTCAGAACTCGGC
GGCAAAAAAAAAAGTATATAAGGCAGAAAGCTTTCTGCCTCTCCGATTTCCTCTCCTTTG
TTTTCTTTTCCGCTTCAATTTACAATCTAGTTCAGCGGCTAATCCTCTTTACCATTGTTT
TCCGTTTATCCTTTGCTCATTCTCCTTTGCTCGATTTCTTTTGCTCGTTTTTTTTTTTTT
TTTTTGCTTCTTTTTTTCTTCTCGCTACTCTGAATAGACG
Chr coordinates Chr X from 265926-268415
w3c xhtml validator w3c css validator