Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SRS2
Systematic Name YJL092W
Alias HPR5, RADH, RADH1
Strain S288c
Description DNA helicase and DNA-dependent ATPase involved in DNA repair, needed for proper timing of commitment to meiotic recombination and transition from Meiosis I to II; blocks trinucleotide repeat expansion; affects genome stability
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SRS2 YJL092W
CTTTACTTGATTCATCAAAACATCGGTGTCATTGCTTCGTGGATTTGTCACCACGGAGTT
GTTCTTTAAGGATCTCCATTTTTCAACTACACAGGCTATCGAGATAGTGTTAGCTACGGG
ACCCAAGCAGGCAGTAATCACAGGGAAATAGCATGAAACCACAAACCAAAAGACGAACAG
TGTTGAAGAAGGCTCTGCATTAATAATACTAACTCTTTCGTCCCGGAACCGCAATGCATC
CTTTAGTTCCTCTGCAAGAACACCCTTAGCTTGCTTCGGTGTGTTGTTTGAATGAGAATC
AACAGCCTGAGCTGAGCTCTCTTGCTCCACTGTCGCCATATTGCCATATCCCAGCGTTTG
TTTGGCAAAGCTGTTCATGAACCTTGTCATATATATAGAAATCGGTAAAATAAATACAAG
AAATATGCTTTGTTATACTGCTAGAAAGGAGTGAAGACATCTGCTCACGATCTACGAGAT
GCGGCTATTTTTGATGGAAAAAGATACATAGGGTCAGGCATTTTTGCCATATTGAATAAC
CAAGATGGTACTGAGTACTCAGGTAATGTATATTACATTGAGTACTTCACTTGTATACAC
AACCACTGCTTCGTATTGTATATCAAGTATCTAACTGTTGATAAACTACAACTTTCTCTT
CAACCATAATGATAGCGCCGCTTAAAACATGCTAGGGTAACGAGACGCGAATGCGAAAAA
CTCCCAAAAAAACCAAAACAAACAAAAGTGACAACAATTAGAACGATGCTGAAGAAGAAT
AGGAGCGAGTTTAGAGTTACCTCCAGCTATCCTGATACTACTGCTTAGGCTACCTTCGCA
GAGTCTCGATAAATTTGCAGTCGGCAAGATAAGAATATTTCTCTACAGCTTTTAGACAGC
TTCCTGTCCCTCTAGTTTCTTTTGCCATCCATAATTGTACTCTGCACTTTGAGTATCATT
CCAATTTGATCTTTCTTCTACCGGTACTTAGGGATAGCAA
Chr coordinates Chr X from 257423-260947
w3c xhtml validator w3c css validator