Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MEF2
Systematic Name YJL102W
Strain S288c
Description Mitochondrial elongation factor involved in translational elongation
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MEF2 YJL102W
CAATTGGTAGCCAGCGGCTGCTGCATTGCTTTATGTTGCTCTAGGAAATGCGACTTTAAA
TTGAGAGTACTCTTCCGTACGGTGGGTATGATGGGGTCATTCATTAAATGTACTGCTTGT
GAAGCTGATATATTATTAGAAGTATTTTCTAAGACGGTCTGGCGGTTATTCGTATTGAAG
TTCGTAATACGTGGAATAGATCCAGCGCTTTGAAAGTTATCATTTATATTATACGTATAT
TGGATATTCGTATTGTGGGCAGGTGTTTTGCCTGGTTTTTCCTGATCTGAAGATAGAAAA
TCTCGCTGCAGATGTACGCTTGAGGGGGATACCGTCTTCGACGGCACATCATGTATTACC
AGCCTCTTCCCCAAATTCAAGTATGGTTGTGTTCCATGCTTCTCAATTCGTTTTCTTGAT
TTCCTTTTCTTATCTCTGCAAAACTTCCCAATATTTCTTTTTAAACAGTTTTGACATGGC
CTCCCTACGTCACACTGTATATGTTTGGTATGACAGAATTCACAAGCTGTCTGGATAGAC
TTTCTCGTCTGTTTCAACTCTGAAGGTAGTTTTTTGGTCATATGTATATATATTCTTGTA
TGCTGTATCCAAATATATTATTTCTTTACTCCCTTTATTGCTAAGCTGTAATACGTTAAA
TCATTCGAAATATGATCTATTCATGCAAAAACTTGATGTGTGTAACAAAGAAAATATCCG
GTTCAGAGATCCGAACAAATGATAGTCGTACCCTTCCCCTTAGTGTTAACTCGTTTAAGC
AGGCTATGATGATTAGTAAATCGTTTCAGCCTCTTCTCATTTCGACAATTTTTGAGGCCT
TCCCTTAGTGAGAGGGGAGATAACCAATCAGCACAGAGAACGACGACGGCGCGGAGGCTG
GGCGGTTAAAAGAAGATAATGTGAAATAGATCAACAAGCTTTCTGGTGGCAAAACGGCAG
TCAGAGATATACAAAAGGGGCAAGATAAGTGAGGGAGGCT
Chr coordinates Chr X from 231301-233760
w3c xhtml validator w3c css validator