Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SET4
Systematic Name YJL105W
Strain S288c
Description Protein of unknown function, contains a SET domain
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SET4 YJL105W
TGATGTCGGTCGTTTGAGGCCCCTTGCGGAAAATCGAGATCGCCGAATGGCACGCGAGGG
AAGGGAAATAAGGTTTAAAGGCACTGAAACAATAGGCAAGAAGTAGGCGAGAGCCGACAT
ACGAGACTAATGTGTCCGCGTTTCTAAGGCCACTTTTCAATGAAACGGATATTGATATGC
TAGTAAAAGGACGAGCTCAAGAGCGAAAATATAAGTAAAGAATTCGAGTGCACTTGTCTC
CATGCAGCAAGATTTCATATGAGTCTTTTTTATCTTTTTACTTTTTACATTACACGATAT
GCACTTTATGAAAATTTAACGAGGTTGGAAGCCGGATAATCAACCAAAATCAGGCACGAA
GGCACACTCGTATATGCATGTTGTTGAAACTCTGTTACGCTGAACTAACAATCACACATG
TAGAGGTCACCGGGAAAAGTTGCGACCCCATGGAAGGTCGATCTCTTCGTTTGGCTTTGC
TTGGCTGGCGGCATTGCGCTTCTTCGCTTATACCCGTCTCTTGACGCTCGAGCTCGTTCA
TTGAGATACCTTTATTCTTGCACATTTTCTGGCTTTTTTCGCTACTCGGGTACATGTAAT
CATGCACACAGAAGGTGCTGTAGGGTGAAAGTTCCTTTGTGCTGTCGTTTGTTTTTAATG
CCAAACTTTCTGGTGATCAATAACCACCTCTTTTTCCTTCAGGAAACCTTATTATTGTTC
TTGGATAGTACTAGGAAGTATATAAGGAACCTCGATTTTGGTATTGCACGGCTATACACA
TCTAAGAAACTTTGTATAAAAGGTGGCTACCCTATTCATAGCTTGATATCAATAGGCCAT
CTCATCACTTTTTATTGAAAAGGAAAGGAGGGAAATATATCTGATTCAAATTACTTGTTT
GCTTCTCTTTAAGACAAAAGCATAGATAATTTCAGCGTGGAACGCCGGAATAAGATTGGT
ACCCTCGTCAGAAAGTTACAAATACCGCTTCATCTTCAAA
Chr coordinates Chr X from 225055-226737
w3c xhtml validator w3c css validator