Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YJL107C
Systematic Name YJL107C
Strain S288c
Description Putative protein of unknown function; expression is induced by activation of the HOG1 mitogen-activated signaling pathway and this induction is Hog1p/Pbs2p dependent; YJL107C and adjacent ORF, YJL108C are merged in related fungi
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YJL107C YJL107C
CTACCTTAATATATCTATTTGATTACACACATTACTTCTTTACCTCTTTGCAACCAGCAC
TTGTCTGTGGCTTTTTGCCGCCGAAGTCTCGCGCCTTTTCCCTGTTGAATTGCATTTAAG
ACACAAGGCTGACATTTATTAATGATAGAGATTTCCACAAAAACTCAAATAGCCGCCGTA
ACATAAATTATTGGACAACCGGAGAAAAGGATATTTTAAGGCACCAGCGGGTAATACATC
TTTATTTCTCCAAGTTTAAAAAGCGTATTTGGAAAAGCTGTGCCACTCAGATTTTTGTGA
GAGTTTTCTTTTTCTACTTACCATGAGTGCGGAGTCTTGGTGAAACAGCTACTGAGAGAA
TAGGTATCTGGGTTACCAGTGTAGTTAGCTACAACATGTTCGAAATGCATGGTAGAGTCT
GGGTTTCGTTCCCTTTGGCTTGTTAAGGCCGAAGATTGCTTTGGTCTGGATGGGCGGAGC
CCAAATTTTATTGTTGAACTATTTTTAGATTAAGAAAAACAGCGCCAAATTTTACCCGGC
TTATGGCTCCTCCCTTGGTACTCCCATTTTTATGACGTAGCAGTTGTCCCGCTTGTTTCA
ACTCCTCGAGAAAAGTGGGGCATTGGGTTTATCTGTCACAGTACCACCAGCACGCCGAAT
GGACCCTCTTTGTCTTAGCCCGACGTCTCCGTAATCAGCGCGCCATTCGTGTTTCTAGTG
TCCTTTGACTATTTTCATCCGAAAAATATCGAAGCAAAGCCATCGCCAAAAATTGCGAAC
CCAATATGACGAAATTCGGAAGAATCTTGAAAAAGAAATAAACCGAATTGCATATTAATA
TATAACTATGTTTTACGTTTGTTTTAAGCCTACTATATCTGAGAACGTAGCTAAATAAAT
CTTATATAACACTTACTTACTTACTTAGCGGTGTGCGACTTTTATCTTTTAGATATAGAA
TAACAAAAGAAAAAAGATCGAATAACCGATAGGCTATACA
Chr coordinates Chr X from 220016-218853
w3c xhtml validator w3c css validator