Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YJL107C
Systematic Name YJL107C
Strain S288c
Description Putative protein of unknown function; expression is induced by activation of the HOG1 mitogen-activated signaling pathway and this induction is Hog1p/Pbs2p dependent; YJL107C and adjacent ORF, YJL108C are merged in related fungi
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YJL107C YJL107C
CTACCTTAATATATCTATTTGATTACACACATTACTTCTTTACCTCTTTGCAACCAGCAC
TTGTCTGTGGCTTTTTGCCGCCGAAGTCTCGCGCCTTTTCCCTGTTGAATTGCATTTAAG
ACACAAGGCTGACATTTATTAATGATAGAGATTTCCACAAAAACTCAAATAGCCGCCGTA
ACATAAATTATTGGACAACCGGAGAAAAGGATATTTTAAGGCACCAGCGGGTAATACATC
TTTATTTCTCCAAGTTTAAAAAGCGTATTTGGAAAAGCTGTGCCACTCAGATTTTTGTGA
GAGTTTTCTTTTTCTACTTACCATGAGTGCGGAGTCTTGGTGAAACAGCTACTGAGAGAA
TAGGTATCTGGGTTACCAGTGTAGTTAGCTACAACATGTTCGAAATGCATGGTAGAGTCT
GGGTTTCGTTCCCTTTGGCTTGTTAAGGCCGAAGATTGCTTTGGTCTGGATGGGCGGAGC
CCAAATTTTATTGTTGAACTATTTTTAGATTAAGAAAAACAGCGCCAAATTTTACCCGGC
TTATGGCTCCTCCCTTGGTACTCCCATTTTTATGACGTAGCAGTTGTCCCGCTTGTTTCA
ACTCCTCGAGAAAAGTGGGGCATTGGGTTTATCTGTCACAGTACCACCAGCACGCCGAAT
GGACCCTCTTTGTCTTAGCCCGACGTCTCCGTAATCAGCGCGCCATTCGTGTTTCTAGTG
TCCTTTGACTATTTTCATCCGAAAAATATCGAAGCAAAGCCATCGCCAAAAATTGCGAAC
CCAATATGACGAAATTCGGAAGAATCTTGAAAAAGAAATAAACCGAATTGCATATTAATA
TATAACTATGTTTTACGTTTGTTTTAAGCCTACTATATCTGAGAACGTAGCTAAATAAAT
CTTATATAACACTTACTTACTTACTTAGCGGTGTGCGACTTTTATCTTTTAGATATAGAA
TAACAAAAGAAAAAAGATCGAATAACCGATAGGCTATACA
Chr coordinates Chr X from 220016-218853
w3c xhtml validator w3c css validator