Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PRM10
Systematic Name YJL108C
Strain S288c
Description Pheromone-regulated protein, proposed to be involved in mating; predicted to have 5 transmembrane segments; induced by treatment with 8-methoxypsoralen and UVA irradiation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PRM10 YJL108C
GTGATCTAGGTATTTCTAATAATGATAACAAAAATGTAAGATTCACTGCTGATACGGATG
CTCTAGAAAATGATTTGTCTTCAAGATCTACAGAAACCAGCGATAATTCTAAGGGCACAG
ATGGACAAGATGAAGAAGATAGGCCTGCTCGCCACAAGAGGAAGCCTAAAGTTTCTTTCA
CACATTTAAGGAACAATGGTAAGGATGGAGACGATGAGACGTTCATCAAGAAGATAATAA
ATAACCTGACTGGAAATCAAGGGGGTTTGGTCCCTGGCTTGGCACCAATACCTTCAGAAA
ATGAAAATGGGAAGAATGATATAGAAAAAAATAACCGTAATGAAGAAATTCCCTTATCCG
ATCTAGCTGATGCGTCTAAAATCGTAGACGTTCATGAGGGCGACGATAAAGAAAAACTGG
AGGCTCTCAAATTAGAAGGTGACGTAAATTGTACGTCGGATGGCGAAACGTTAGGCTCAA
GTTCAAAAAATTCATTTCTGGCTCCTGCAGTGGATCATTTTGATGATTATGCAGAAAACA
ATTCATCCGACGATAACGAAGGGTTTATTGAAACCTCCACATACGTACCCCCTCCATCTC
AAGTGAAAAGTGGAGTACTAGGGTCATTATTGAAACTTTACCAAAATGAAGATCAAAATT
CAAGCTCAATCTTTTCAGATTCACAAGCTGTAACAACAGATGATGAAGGTATTTCTTCTA
CTGCTGGAAACAAAGACGTACCAGTTGCCAAGCGTAGCAGATTACAAAATTTAAAAGGCA
AGGCTAAAAAAGGCAGAATGCCTAGACTGAAGAAAAGACTAAAAACTGAAGCGAAAATTA
CGGTTCACATTGCAGACATTTTACAAAGACACCGGTTCATCCTACGCATGTGTAGAGCTC
TTATGATGTATGGTGCTCCGACGCATAGGCTTGAAGAATATATGGTTATGACTTCTAGAG
TCCTTGAAATAGATGGTCAGTTTTGTATCTTCCAGGTTGT
Chr coordinates Chr X from 218856-217705
w3c xhtml validator w3c css validator